Real-time PCR
Real-time PCR
M. Tevfik Dorak (Ed.)
School of Clinical Medical Sciences (Child Health)
Newcastle University
Newcastle-upon-Tyne, UK
Published by:
Taylor & Francis Group
In US: 270 Madison Avenue
New York, N Y 10016
In UK: 2 Park Square, Milton Park
Abingdon, OX14 4RN
© 2006 by Taylor & Francis Group
This edition published in the Taylor & Francis e-Library, 2007.
“To purchase your own copy of this or any of Taylor & Francis or Routledge’s
collection of thousands of eBooks please go to www.eBookstore.tandf.co.uk.”
ISBN 0–203–96731–3 Master e-book ISBN
ISBN: 0-4153-7734-X (Print Edition)
This book contains information obtained from authentic and highly regarded sources. Reprinted material is
quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts
have been made to publish reliable data and information, but the author and the publisher cannot assume
responsibility for the validity of all materials or for the consequences of their use.
All rights reserved. No part of this book may be reprinted, reproduced, transmitted, or utilized in any form
by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying,
microfilming, and recording, or in any information storage or retrieval system, without written permission
from the publishers.
A catalog record for this book is available from the British Library.
Library of Congress Cataloging-in-Publication Data
Real-time PCR/M. Tevfik Dorak (ed.).
p. cm.
Includes bibliographical references and index.
ISBN 1-415-37734-X (alk. paper)
1. Polymerase chain reaction. I. Dorak, M. Tevfik.
[DNLM: 1. Polymerase Chain Reaction – methods. QU 450
R2874 2006]
QP 606.D46R43 2006 .
572′.43–dc22
Editor: Elizabeth Owen
Editorial Assistant: Kirsty Lyons
Production Editor: Karin Henderson
Taylor & Francis Group, an informa business
Visit our web site at http://www.garlandscience.com
Contents
Contributors xiii
Abbreviations xv
Preface xvii
Glossary xix
Links to software and web resources cited xxv
1 An introduction to real-time PCR 1
Gregory L. Shipley
1.1 Introduction 1
1.2 A brief history of nucleic acid detection and quantification 1
1.3 Real-time quantitative PCR – a definition 3
1.4 Practical and theoretical principles underlying real-time PCR 3
1.5 Real-time PCR instrumentation – an overview 12
1.6 Detection chemistries used in real-time PCR 16
1.7 Performing a real-time RT-PCR experiment 25
1.8 What lies ahead 29
References 30
Protocol 1.1 32
Protocol 1.2 33
Protocol 1.3 35
Protocol 1.4 36
Protocol 1.5 37
2 Data analysis and reporting 39
Pamela Scott Adams
2.1 Introduction 39
2.2 Standard curves 40
2.3 Preliminary assay analysis 45
2.3.1 Amplification curves 46
2.3.2 Baseline 47
2.3.3 Threshold 50
2.3.4 Proper controls 52
2.3.5 Experimental samples 56
2.3.6 Quantifying data 57
2.4 Data reporting and statistics 59
References 61
vi Contents
3 Relative quantification 63
Michael W. Pfaffl
3.1 Introduction 63
3.2 Relative quantification: The quantification is relative to what? 64
3.3 Normalization 65
3.4 Mathematical models 66
3.5 Real-time qPCR amplification efficiency 68
3.6 Determination of the amplification rate 69
3.6.1 Dilution method 70
3.6.2 Fluorescence increase in exponential phase 71
3.6.3 Sigmoidal or logistic curve fit 72
3.6.4 Efficiency calculation in the exponential phase using 73
multiple models
3.7 What is the right crossing point to determine? 75
3.8 Relative quantification data analysis and software applications 76
3.8.1 LightCycler® Relative Quantification Software 76
3.8.2 REST 77
3.8.3 Q-Gene 78
3.8.4 qBASE 78
3.8.5 SoFAR 79
3.8.6 DART-PCR 79
3.9 Conclusion 79
References 80
4 Normalization 83
Jim Huggett, Keertan Dheda and Stephen A. Bustin
4.1 Introduction 83
4.2 General error and directional shift 83
4.3 Methods of normalization 84
4.3.1 Sample size 84
4.3.2 Total RNA amount 86
4.3.3 Quantification of cDNA 87
4.3.4 PCR dependent reference 87
4.4 Conclusion 90
References 90
5 High-throughput primer and probe design 93
Xiaowei Wang and Brian Seed
5.1 Primer and probe design guidelines 93
5.1.1 Primer specificity 93
5.1.2 Primer length 93
5.1.3 Primer GC content 93
5.1.4 Primer 3’ end stability 94
5.1.5 Primer sequence complexity 94
5.1.6 Primer melting temperature 94
5.1.7 Primer location in the sequence 95
5.1.8 Amplicon size 96
5.1.9 Cross-exon boundary 96
5.1.10 Primer and template sequence secondary structures 96
5.1.11 TaqMan® probe design 96
Contents vii
5.1.12 Molecular beacon probe design 97
5.2 PrimerBank – an online real-time PCR primer database 97
5.2.1 Primer design algorithm 97
5.2.2 PrimerBank 100
5.2.3 Experimental validation of the primer design 101
5.3 Experimental protocol using PrimerBank primers 101
5.3.1 Reverse transcription (RT) 101
5.3.2 Real-time PCR 102
5.3.3 Troubleshooting 103
5.3.4 Little or no PCR product 103
5.3.5 Poor PCR amplification efficiency 103
5.3.6 Primer dimer 103
5.3.7 Multiple bands on gel or multiple peaks in the melting curve 104
5.3.8 Non-specific amplification 104
5.4 Web resources about primer and probe design 104
5.4.1 Real-time PCR primer and probe databases 104
5.4.2 Primer and probe design tools 104
5.4.3 Other useful web sites 105
References 105
6 Quantitative analysis of ocular gene expression 107
Stuart N. Peirson
Summary 107
6.1 Introduction 107
6.1.1 Gene expression in the eye 107
6.1.2 Problems associated with ocular gene expression 108
6.2 Relative quantification 112
6.2.1 The R0 method 112
6.2.2 Kinetic approaches to qPCR 114
6.2.3 Accurate normalization 116
6.3 Assay considerations 118
6.4 Conclusions 124
Acknowledgments 124
References 124
7 Quantitative gene expression by real-time PCR: a complete protocol 127
Thomas D. Schmittgen
7.1 Introduction 127
7.2 Materials 127
7.2.1 Reagents and consumables 127
7.2.2 Equipment 128
7.3 Procedure 128
7.3.1 Sample preparation 128
7.3.2 Isolation of RNA from cultured cells or blood 128
7.3.3 Isolation of RNA from whole tissue 129
7.3.4 RNA quantification 130
7.3.5 DNase treatment 130
7.3.6 cDNA synthesis 130
7.3.7 SYBR® Green 131
7.3.8 Primer design 131
viii Contents
7.3.9 Real-time PCR 132
7.3.10 Data analysis 133
7.4 Troubleshooting 135
7.5 Critical steps 136
7.6 Comments 136
References 137
8 Real-time PCR using SYBR® Green 139
Frederique Ponchel
8.1 Introduction 139
8.2 SYBR® Green chemistry 139
8.3 Primer design 140
8.3.1 Step by step primer design: β-actin for a cDNA quantification 141
assay
8.4 Primer optimization 142
8.4.1 Absolute quantification of gene expression 142
8.4.2 Relative quantification of gene expression 142
8.4.3 Relative quantification of different gene modifications 145
(amplification, deletion, rearrangement, translocation)
8.5 Melting curve analysis 146
8.6 Quantification of gene modification 146
8.6.1 DNA quantification 147
8.6.2 Gene amplification 147
8.6.3 Gene deletion 147
8.6.4 Gene rearrangement 148
8.6.5 Gene copy number 149
8.7 RNA quantification 149
8.7.1 RNA extraction 149
8.7.2 cDNA preparation 149
8.7.3 Reference gene validation 150
8.7.4 Splice variants and splicing machinery 150
8.7.5 Promoter switch 150
8.8 Allelic discrimination 152
8.9 Chromatin immunoprecipitation 152
8.10 Conclusion 152
References 153
9 High-resolution melting analysis for scanning and genotyping 155
Virginie Dujols, Noriko Kusukawa, Jason T. McKinney, Steven F. Dobrowolsky
and Carl T. Wittwer
9.1 Introduction 155
9.2 High-resolution instrumentation 156
9.2.1 The HR-1TM instrument 156
9.2.2 The LightScannerTM instrument 156
9.2.3 The LightCycler® 480 instrument 157
9.3 Saturating dyes 157
9.3.1 LCGreenTM dyes 158
9.4 Mutation scanning 159
9.4.1 PCR protocols for scanning 159
9.4.2 Principles of scanning by melting 160
Contents ix
9.4.3 Software tools for heterozygote identification 161
9.4.4 Scanning for homozygous variants 163
9.5 Amplicon genotyping 163
9.6 Unlabeled probe genotyping 164
9.6.1 PCR protocols for unlabeled probe genotyping 164
9.6.2 Instrumentation for unlabeled probe genotyping 165
9.6.3 Simultaneous genotyping and scanning 165
9.7 Simplification of genotyping and mutation scanning 165
References 167
10 Quantitative analyses of DNA methylation 171
Lin Zhou and James (Jianming) Tang
10.1 Introduction 171
10.2 MDR1 (ABCB1, Gene ID 5243) as a primary target locus 172
10.3 Primer design 173
10.4 Data evaluation: I. Assay-to-assay variability 174
10.5 Data evaluation: II. MDR1 CpG methylation as quantified by qPCR 174
10.6 Expanded analyses 176
Acknowledgments 176
References 176
Protocol 10.1 179
11 Mitochondrial DNA analysis 183
Steve E. Durham and Patrick F. Chinnery
11.1 Introduction 183
11.2 Mitochondrial genetics 183
11.2.1 mtDNA mutations 185
11.2.2 mtDNA copy number and heteroplasmy 185
11.2.3 The threshold effect 185
11.2.4 Mutation rate of mtDNA 186
11.2.5 Mitochondrial DNA, ageing and disease 186
11.3 Mitochondrial DNA analysis by real-time PCR 189
11.3.1 Detection method 189
11.3.2 Oligonucleotide fluorescent probes 189
11.3.3 DNA binding dyes 190
11.3.4 Considerations when designing a mtDNA real-time assay 191
11.4 Discussion 201
References 203
12 Real-time immuno-PCR 205
Kristina Lind and Mikael Kubista
12.1 Introduction 205
12.1.1 Immunoassays 205
12.1.2 Immuno-PCR 205
12.2 Assemblages for real-time immuno-PCR 206
12.2.1 Attaching capture antibody 207
12.2.2 Labeling detection antibody with DNA 207
12.3 Real-time immuno-PCR details 207
12.3.1 Reaction containers and instruments 207
12.3.2 DNA-label 208
x Contents
12.3.3 Blocking agents 208
12.3.4 Controls 208
12.3.5 Optimizing concentrations 209
References 210
Protocol 12.1 211
13 Clinical microbiology 219
Burcu Cakilci and Mehmet Gunduz
13.1 Introduction 219
13.1.1 Importance of detection and quantification in microbiology 219
13.1.2 From traditional methods to real-time PCR in microbiology 219
13.2 Real-time PCR studies in microbiology 220
13.2.1 Basics for microbial quantitation 220
13.2.2 Bacteria 221
13.2.3 Fungi and parasites 224
References 225
Protocol 13.1 229
14 Clinical virology 231
David M. Whiley and Theo P. Sloots
14.1 Introduction 231
14.2 Qualitative real-time PCR for viral disease 232
14.2.1 Sequence variation and assay performance 232
14.3 Virus typing using sequence-specific probes 236
14.3.1 Hybridization probes 236
14.3.2 Additional comments 239
14.4 Quantification of viral load 239
14.4.1 The use of an internal control in clinical molecular virology 239
14.4.2 Impact of target sequence variation on qPCR 240
14.4.3 Additional comments 241
14.5 Conclusions 242
References 242
Protocol 14.1 244
Protocol 14.2 246
Protocol 14.3 248
Protocol 14.4 250
Troubleshooting guide 14.1 251
Troubleshooting guide 14.2 254
Troubleshooting guide 14.3 256
Troubleshooting guide 14.4 257
15 Solid organ transplant monitoring 259
Omaima M. Sabek
15.1 Introduction 259
15.2 Real-time quantitative PCR 260
15.3 RNA normalization 260
15.4 Immunologic monitoring in solid organ transplantation 261
15.5 Pharmacogenetics in solid organ transplantation 261
15.6 Cytokine gene polymorphism analysis 262
15.6.1 Recipient and donor gene polymorphisms 263
Contents xi
15.6.2 Ethnicity and cytokine gene polymorphism 263
15.7 Viral infection in transplant patients 264
References 265
Protocol 15.1 270
16 Real-time PCR applications in hematology 277
Anne M. Sproul
16.1 Specimens 278
16.2 Specimen quality 278
16.3 Template preparation 278
16.4 DNA isolation 278
16.5 PCR inhibition 278
16.6 RNA isolation 279
16.7 cDNA synthesis 279
16.8 Relative versus absolute quantitation 280
16.9 Control genes for MRD in leukemia 281
16.10 Controls for real-time PCR 282
16.11 Assay design 283
16.12 Laboratory precautions 283
16.13 PCR reaction set-up 284
16.14 Interpretation and quantitation 284
16.15 Sensitivity 285
16.16 Targets for detecting MRD 285
16.16.1 Fusion transcripts 285
16.16.2 Rearrangements of immunoglobulin/ 287
TCR genes in lymphoid neoplasia
References 288
Protocol 16.1 290
Protocol 16.2 298
17 Real-time PCR for prenatal diagnosis of monogenic 301
diseases caused by single nucleotide changes –
the example of the hemoglobinopathies
Joanne Traeger-Synodinos, Christina Vrettou and Emmanuel Kanavakis
17.1 Introduction to prenatal diagnosis (PND) in clinical
genetics 301
17.2 Classic mutation detection methods for prenatal
diagnosis of monogenic diseases and best practice guidelines 302
17.2.1 Classic mutation detection methods 302
17.2.2 Best practice guidelines for prenatal diagnosis 302
17.3 Sources of fetal samples for prenatal diagnosis 303
17.4 Real-time PCR protocols for PND and PGD applied to
the hemoglobinopathies – background and design of
protocols 303
17.4.1 Real-time PCR and allele discrimination using
the LightCycler® (system 1.0 or 1.5) 303
17.4.2 Molecular basis of β-hemoglobinopathies 304
17.4.3 Principles behind design of LightCycler® probe
sets and assays in the β-globin gene (appropriate
for Systems 1.0 and 1.5) 304
xii Contents
17.4.4 Additional considerations in design of single-cell
genotyping for PGD using real-time PCR 307
17.4.5 Potential advantages of real-time PCR protocols
for PND and PGD 307
References 309
Protocol 17.1 310
Protocol 17.2 312
Protocol 17.3 314
Protocol 17.4 315
Protocol 17.5 320
Protocol 17.6 323
Protocol 17.7 325
Protocol 17.8 326
Index 329
Contributors
Pamela Scott Adams, Trudeau Institute, 154 Algonquin Avenue, Saranac Lake, NY 12983,
USA
Stephen A. Bustin, Institute of Cell and Molecular Science, Barts and the London, Queen
Mary’s School of Medicine and Dentistry, London, E1 1BB, UK
Burcu Cakilci, Department of Periodontology, Gazi University Dental School, Ankara,
Turkey
Patrick F. Chinnery, Mitochondrial Research Group, Neurology, M4009, University of
Newcastle upon Tyne, Medical School, Framlington Place, Newcastle upon Tyne, NE2 4HH,
UK
Keertan Dheda, Centre for Infectious Diseases and International Health, University College
London, London, W1T 4JF, UK
Steven F. Dobrowolsky, Idaho Technology, Wakara Way, Salt Lake City, UT 84108, USA
Virginie Dujols, Idaho Technology, Wakara Way, Salt Lake City, UT 84108, USA
Steve E. Durham, Mitochondrial Research Group, Neurology, M4009, University of
Newcastle upon Tyne, Medical School, Framlington Place, Newcastle upon Tyne, NE2 4HH,
UK
Mehmet Gunduz Department of Oral Pathology and Medicine, Okayama University School
of Medicine and Dentistry, Okayama, Japan
Jim Huggett, Centre for Infectious Diseases and International Health, University College
London, London, W1T 4JF, UK
Emmanuel Kanavakis, Department of Medical Genetics, National and Kapodistrian
University of Athens, St. Sophia’s Children’s Hospital, Athens 11527, Greece
Mikael Kubista, Department of Chemistry and Bioscience, Chalmers University of
Technology, and TATAA Biocenter, Box 462, 405 30 Gothenburg, Sweden
Noriko Kusukawa, Department of Pathology, University of Utah Medical School, Salt Lake
City, UT 84132, USA
Kristina Lind, Department of Chemistry and Bioscience, Chalmers University of
Technology, and TATAA Biocenter, Box 462, 405 30 Gothenburg, Sweden
Jason T. McKinney, Idaho Technology, Wakara Way, Salt Lake City, UT 84108, USA
Stuart N. Peirson, Department of Visual Neuroscience, Division of Neuroscience and Mental
Health, Imperial College, Charing Cross Hospital, Fulham Palace Road, London, W6 8RF, UK
Michael W. Pfaffl, Institute of Physiology, Center of Life and Food Science Weihenstephan,
Technical University of Munich, 85354 Freising, Weihenstephaner Berg 3, Germany
Frederique Ponchel, Molecular Medicine Unit, University of Leeds, Clinical Sciences
Building, St James’s University Hospital, Leeds, LS9 7TF, UK
xiv Contributors
Omaima M. Sabek, University of Tennessee Health Science Center, Memphis, TN 38103,
USA
Thomas D. Schmittgen, College of Pharmacy, The Ohio State University, 500 West 12th
Avenue, Columbus, OH 43210, USA
Brian Seed, Massachusetts General Hospital and Harvard Medical School, 50 Blossom Street,
Boston, MA 02114, USA
Gregory L. Shipley, Department of Integrative Biology and Pharmacology, The University of
Texas Health Sciences Center Houston, 6431 Fannin St, Houston, TX 77030, USA
Theo P. Sloots, Clinical Virology Research Unit, Sir Albert Sakzewski Virus Research Centre,
Royal Children’s Hospital and Clinical Medical Virology Centre, University of Queensland,
Brisbane, Australia
Anne M. Sproul, Department of Haematology, Western General Hospital, Crewe Road
South, Edinburgh, EH4 2XU, UK
Joanne Traeger-Synodinos, Department of Medical Genetics, National and Kapodistrian
University of Athens, St. Sophia’s Children’s Hospital, Athens 11527, Greece
James (Jianming) Tang, Division of Geographic Medicine, Department of Medicine,
University of Alabama at Birmingham, Birmingham, AL 35294, USA
Christina Vrettou, Department of Medical Genetics, National and Kapodistrian University
of Athens, and Research Institute for the Study of Genetic and Malignant Disorders in
Childhood, St. Sophia’s Children’s Hospital, Athens 11527, Greece
Xiaowei Wang, Ambion Inc., 2130 Woodward Street, Austin, TX 78744, USA
David M. Whiley, Clinical Virology Research Unit, Sir Albert Sakzewski Virus Research
Centre, Royal Children’s Hospital and Clinical Medical Virology Centre, University of
Queensland, Brisbane, Australia
Carl T. Wittwer, Department of Pathology, UUMC, 5B418, 50 N. Medical Drive, Salt Lake
City, UT 84105, USA
Lin Zhou, Division of Geographic Medicine, Department of Medicine, University of Alabama
at Birmingham, Birmingham, AL 35294, USA
Abbreviations
ACR Acute cellular rejection ds Double-stranded
ALL Acute lymphoblastic leukemia dTTP Deoxythymidine triphosphate
ARMS Amplification refractory dUTP 2’ deoxyurindine
mutation system 5’ triphosphate
ARP Acidic ribosomal EAC Europe against cancer
phosphoprotein EBV Epstein–Barr virus
ASO Allele-specific oligonucleotide ELISA Enzyme-linked immunosorbent
ATP Adenosine triphosphate assay
β2m β2-microglobulin (B2M) FACS Fluorescent-assisted cell
BC Background control (in sorting
immuno-PCR) FAM 6-carboxy fluorescein
BHQ Black hole quencher FDM First derivative maximum
BKV BK virus FISH Fluorescence in-situ
BLAST Basic local alignment search hybridization
tool FITC Fluorescein
BSA Bovine serum albumin FRET Fluorescence resonance energy
CCD Charge-coupled device transfer
cDNA Complementary DNA GAPDH glyceraldehyde-3-phosphate
ChIP Chromatin dehydrogenase
immunoprecipitation gDNA Genomic DNA
CML Chronic myeloid leukemia GOI Gene of interest
CMV Cytomegalovirus GUS β-glucuronidase
COX Cytochrome c oxidase HBV Hepatitis B virus
Cp Crossing point (LightCycler® HCV Hepatitis C virus
terminology) HEP Human tpigenome Project
CRS Cambridge Reference Sequence HEX Hexachloro-carbonyl-
Ct Threshold cycle (ABI fluorescein
terminology) HKG House keeping gene
CTAB Cetyltrimethylammonium HPLC High-performance liquid
Bromide chromatography
CV Coefficient of variation HPRT Hypoxanthine phosphoribosyl-
(standard deviation divided by transferase 1
the mean) HSV Herpes simplex virus
CVS Chorionic villi sampling GOI Gene of interest
CYC cyclophilin IC Internal control (normalizer,
DABCYL 4-(dimethylamino)azobenzene- reference)
4′-carboxylic acid IFN Interferon
DABSYL 4-(dimethylamino)azobenzene- IL Interleukin
4′-sulfonyl chloride IPC Internal positive control
DART Data analysis for real-time PCR IVF In-vitro fertilization
DFA Direct fluorescence assay JOE 2, 7-dimethoxy-4, 5-dichloro-6-
DGGE Denaturing gradient gel carboxy-fluoroscein
electrophoresis KOD Kinetic outlier detection
xvi Abbreviations
LATE PCR Linear after the exponential PCR r2 R-squared or coefficient of
LCM Laser capture microdissection determination (varies between 0
LED Light emitting diode and +1)
LiCl Lithium Chloride rCRS Revised Cambridge Reference
LNA Locked nucleic acid Sequence
LUX™ Light upon eXtension REST Relative expression software
m
C Methylated cytosine tool
MDR1 Multidrug resistance protein 1 REST-MCS REST – multiple condition
MGB Minor groove binders solver
MHC Major histocompatibility REST-RG REST Rotor-Gene
complex RFLP Restriction fragment length
MMF Mycophenolate mofetil polymorphism
MRD Minimal residual disease ΔRn Normalized reporter signal
mRNA Messenger RNA minus background fluorescence
MSE Mean squared error (nothing to –RTC Minus reverse transcriptase
do with SEM) control
MSP Methylation-specific PCR Rn Normalized raw fluorescence
mtDNA Mitochondrial DNA (see also ROS Reactive oxygen species
nDNA) ROX 6-carboxy-X-rhodamine
NAC No amplification control rRNA Ribosomal RNA
NASBA Nucleic acid sequence based RSV Respiratory syncytial virus
amplification RT Reverse transcription
nDNA Nuclear DNA (as opposed to SD Standard deviation
mtDNA) SDM Second derivative maximum
NF Normalization factor SDS Sequence Detection Software
NTC No template control (no target SEM Standard error of the mean
control) SMCC Succinimidyl-4-(N-
OD Optical density maleimidomethyl) cyclohexane-
OD260 Optical density at 260 nm l-carboxylate
PAGE Polyacrylamide gel SNP Single nucleotide
electrophoresis polymorphism
PCR Polymerase chain reaction STR Short tandem repeat
PCV Packed cell volume TAMRA 6-carboxy-tetra-methyl-
PGD Preimplantation genetic rhodamine
diagnosis TBP TATA-binding protein
PGK Phosphoglycerokinase TCA Trichoroacetic acid
PMT Photomultiplier tube TCR T-cell receptor
PND Prenatal diagnosis TE buffer Tris-EDTA buffer
PTLD Post-transplant TfR Transferrin receptor
lymphoproliferative disorders Tm Melting temperature
qPCR Quantitative PCR TREC T-cell receptor excision circles
r (Pearson’s) coefficient of tRNA Transfer RNA
correlation (varies between –1 UNG Uracil-N-glycosylase
and +1) y-int y-intercept
Preface
Polymerase chain reaction (PCR) has secured its place in biomedical history as a revolution-
ary method. Many techniques that have derived from PCR have come and gone. Real-time
PCR is based on the conventional principles of PCR and since its beginnings about a decade
ago its popularity has kept growing. With the simple shift of emphasis from the end-product
to the whole course of the PCR process, real-time PCR has established itself as the most sensi-
tive and specific quantitative PCR method. The real-time PCR concept has also contributed
to the development of high-throughput allelic discrimination assays. With a variety of detec-
tion chemistries, an increasing number of platforms, multiple choices for analytical methods
and the jargon emerging along with these developments, real-time PCR is facing the risk of
becoming an intimidating method, especially for beginners. This book aims to provide the
basics, explain how they are exploited to run a real-time PCR assay, how the assays are run
and where these assays are informative in real life. The book does not intend to cover every
aspect of real-time PCR in an encyclopedic fashion but instead to address the most practical
aspects of the techniques with the emphasis on ‘how to do it in the laboratory’. Keeping with
the spirit of the Advanced Methods Series, most chapters provide an experimental protocol
as an example of a specific assay. It is left with the reader to adapt the presented protocol to
their individual needs.
The book is organized in two parts. The first part begins with a general introduction which
is followed by chapters on the basics of data analysis, quantification, normalization and
principles of primer and probe design, all contributed by leaders in the field. This part is
concluded by chapters on more applied aspects of real-time PCR including an overview of
high-resolution melting analysis by the most experienced users of this method. The second
part of the book covers specific applications including the less recognized uses of real-time
PCR: methylation detection, mitochondrial DNA analysis and immuno-PCR. The following
chapters summarize many uses of real-time PCR in the clinic with examples. Clinical micro-
biology and virology, solid organ and bone marrow transplantation, and prenatal genetic
diagnosis are among the topics covered. These chapters have been written with the labora-
tory and practical uses in mind and the contributors share their most valuable experiences. A
comprehensive glossary and index supplement the 17 chapters and aim to make the book
more accessible.
Real-time PCR is, like any other modern method in molecular genetics, expanding, with
potential applications even in proteomics. This book is expected to provide the basic prin-
ciples of applied real-time PCR and provide a firm grounding for those who wish to develop
further applications. The selection of the chapters reflects the acknowledgment of inevitable
future developments. We look forward to covering those in future editions of the book. Real-
time PCR is surely here to stay and hopefully this book will help current users of this
technique and also help develop further applications for it.
M. Tevfik Dorak
Glossary
This glossary has been adapted from the Editor’s Real-Time PCR webpage (http://
www.dorak.info/genetics/realtime.html). The online version includes references and hyper-
links.
Absolute quantification: The absolute quantitation assay is used to quantitate unknown
samples by interpolating their quantity from a standard curve (as in determination of viral
copy number).
Allelic discrimination assay: Assays designed to type for gene variants. Either differentially
labeled probes (one for each variant) or a single probe and melting curve analysis can be used
for this purpose. Alternatively, dsDNA-binding dyes can be used in combination with
melting curve analysis.
Amplicon: The amplified sequence of DNA in the PCR process.
Amplification plot: The plot of cycle number versus fluorescence signal which correlates
with the initial amount of target nucleic acid during the exponential phase of PCR.
Anchor & reporter probes: Two partnering LightCycler ® probes that hybridize on the target
sequence in close proximity. The anchor probe (donor) emits the fluorescein to excite the
reporter probe (acceptor) to initiate fluorescence resonance energy (FRET). In allelic discrim-
ination assays, it is important that the reporter probe spans the mutation and has a lower Tm
than the anchor probe.
Baseline: The initial cycles of PCR during which there is little change in fluorescence signal
(usually cycles 3 to 15).
Baseline value: During PCR, changing reaction conditions and environment can influence
fluorescence. In general, the level of fluorescence in any one well corresponds to the amount of
target present. Fluorescence levels may fluctuate due to changes in the reaction medium
creating a background signal. The background signal is most evident during the initial cycles of
PCR prior to significant accumulation of the target amplicon. During these early PCR cycles, the
background signal in all wells is used to determine the ‘baseline fluorescence’ across the entire
reaction plate. The goal of data analysis is to determine when target amplification is sufficiently
above the background signal, facilitating more accurate measurement of fluorescence.
Calibrator: A single reference sample used as the basis for relative-fold increase in expression
studies (assuming constant reaction efficiency).
Coefficient of variance (CV): Used as a measure of experimental variation. It is important
that a linear value (e.g., copy numbers) is used to calculate the CV (but not Ct values which
are logarithmic). Intra-assay CV quantifies the amount of error seen within the same assay (in
duplicates) and inter-assay CV quantifies the error between separate assays.
Ct (threshold cycle): Threshold cycle reflects the cycle number at which the fluorescence
generated within a reaction crosses the threshold. It is inversely correlated to the logarithm
of the initial copy number. The Ct value assigned to a particular well thus reflects the point
during the reaction at which a sufficient number of amplicons have accumulated. Also called
crossing point (Cp) in LightCycler® terminology.
xx Glossary
Derivative curve: This curve is used in Tm analysis. It has the temperature in the x axis and
the negative derivative of fluorescence (F) with respect to temperature (T), shown as dF/dT,
on the y axis. The reproducibility of a derivative melting curve is high with a standard devia-
tion of only 0.1°C between runs.
dsDNA-binding agent: A molecule that emits fluorescence when bound to dsDNA. The
prototype is SYBR® Green I. In real-time PCR, the fluorescence intensity increases propor-
tionally to dsDNA (amplicon) concentration. The problem with DNA-binding agents is that
they bind to all dsDNA products: specific amplicon or non-specific products (misprimed
targets and primer-dimers included). For this reason, analysis using DNA-binding agents is
usually coupled with melting analysis.
Dynamic range: The range of initial template concentrations over which accurate Ct values
are obtained. If endogenous control is used for ΔΔCt quantitation method, dynamic ranges of
target and control should be comparable. In absolute quantitation, interpolation within this
range is accurate but extrapolation beyond the dynamic range should be avoided. The larger
the dynamic range, the greater the ability to detect samples with high and low copy number
in the same run.
Efficiency of the reaction: The efficiency of the reaction can be calculated by the following
equation: E = 10(–1/slope) – 1. The efficiency of the PCR should be 90–100% meaning doubling
of the amplicon at each cycle. This corresponds to a slope of 3.1 to 3.6 in the Ct vs log-
template amount standard curve. In order to obtain accurate and reproducible results,
reactions should have efficiency as close to 100% as possible (e.g., two-fold increase of ampli-
con at each cycle) and, in any case, efficiency should be similar for both target and reference
(normalizer, calibrator, endogenous control, internal control). A number of variables can
affect the efficiency of the PCR. These factors can include length of the amplicon, presence
of inhibitors, secondary structure and primer design. Although valid data can be obtained
that fall outside of the efficiency range, if it is <0.90, the quantitative real-time PCR should
be further optimized or alternative amplicons designed.
Endogenous control: This is an RNA or DNA that is naturally present in each experimental
sample. By using an invariant endogenous control as an active ‘reference’, quantitation of a
messenger RNA (mRNA) target can be normalized for differences in the amount of total RNA
added to each reaction and correct for sample-to-sample variations in reverse transcriptase
PCR efficiency.
Exogenous control: This is a characterized RNA or DNA spiked into each sample at a known
concentration. An exogenous active reference is usually an in vitro construct that can be used
as an internal positive control (IPC) to distinguish true target negatives from PCR inhibition.
An exogenous reference can also be used to normalize for differences in efficiency of sample
extraction or complementary DNA (cDNA) synthesis by reverse transcriptase. Whether or not
an active reference is used, it is important to use a passive reference dye (usually ROX–6-
carboxy-X-rhodamine) in order to normalize for non-PCR-related fluctuations in fluores-
cence signal.
FAM: 6-carboxy fluorescein. Most commonly used reporter dye at the 5’ end of a TaqMan®
probe.
Fluorescence resonance energy transfer (FRET): The interaction between the electronic
excited states of two dye molecules. The excitation is transferred from one (the donor) dye
molecule to the other (the acceptor) dye molecule. FRET is distance dependent and occurs
when the donor and the acceptor dye are in close proximity.
Glossary xxi
Housekeeping gene: Genes that are widely expressed in abundance and are usually used as
reference genes for normalization in real-time PCR with the assumption of ‘constant expres-
sion’. The current trend is first to check which housekeeping genes are suitable for the target
cell or tissue and then to use more than one of them in normalization.
Hybridization probe: One of the main fluorescence-monitoring systems for DNA ampli-
fication. LightCycler® probes are hybridization probes and are not hydrolyzed by Taq
Polymerase. For this reason, melting curve analysis is possible with hybridization probes.
Hydrolysis probe: One of the main fluorescence-monitoring systems for DNA amplification.
TaqMan® probes are an example. These kinds of probes are hydrolyzed by the 5’ endonucle-
ase activity of Taq Polymerase during PCR.
Internal positive control (IPC): An exogenous IPC can be added to a multiplex assay or run
on its own to monitor the presence of inhibitors in the template. Most commonly the IPC is
added to the PCR master mix to determine whether inhibitory substances are present in the
mix. Alternatively, it can be added at the point of specimen collection or prior to nucleic acid
extraction to monitor sample stability and extraction efficiency, respectively.
Log-dilution: Serial dilutions in powers of 10 (10, 100, 1000 etc).
LUX™ (Light upon eXtension) primers: Created by Invitrogen, LUX™ primer sets include
a self-quenched fluorogenic primer and a corresponding unlabeled primer. The labeled
primer has a short sequence tail of 46 nucleotides on the 5’ end that is complementary to the
3’ end of the primer. The resulting hairpin secondary structure provides optimal quenching
of the fluorophore. When the primer is incorporated into double-stranded DNA during PCR,
the fluorophore is dequenched and the signal increases by up to ten-fold. By eliminating the
need for a quencher dye, the LUX™ primers reduce the cost.
Melting curve (dissociation) analysis: Every piece of dsDNA has a melting point (Tm) at
which temperature 50% of the DNA is single stranded. The temperature depends on the
length of the DNA, sequence order, G:C content and Watson–Crick pairing. When DNA-
binding dyes are used, as the fragment is heated, a sudden decrease in fluorescence is detected
when Tm is reached (due to dissociation of DNA strands and release of the dye). This point is
determined from the inflection point of the melting curve or the melting peak of the deriva-
tive plot (what is meant by derivative plot is the negative first-derivative of the melting
curve). The same analysis can be performed when hybridization probes are used as they are
still intact after PCR. As hydrolysis probes (e.g., TaqMan®) are cleaved during the PCR
reaction, no melting curve analysis possible if they are used. Mismatch between a hybridiza-
tion probe and the target results in a lower Tm. Melting curve analysis can be used in known
and unknown (new) mutation analysis as a new mutation will create an additional peak or
change the peak area.
Minor groove binders (MGBs): These dsDNA-binding agents are attached to the 3’ end of
TaqMan® probes to increase the Tm value (by stabilization of hybridization) and to design
shorter probes. Longer probes reduce design flexibility and are less sensitive to mismatch
discrimination. MGBs also reduce background fluorescence and increase dynamic range due
to increased efficiency of reporter quenching. By allowing the use of shorter probes with
higher Tm values, MGBs enhances mismatch discrimination in genotyping assays.
Minus reverse transcriptase control (–RTC): A quantitative real-time PCR control sample
that contains the starting RNA and all other components for one-step reaction but no reverse
transcriptase. Any amplification suggests genomic DNA contamination.
xxii Glossary
Molecular beacons: These hairpin probes consist of a sequence-specific loop region flanked
by two inverted repeats. Reporter and quencher dyes are attached to each end of the molecule
and remain in close contact unless sequence-specific binding occurs and reporter emission
(FRET) occurs.
Multiplexing: Simultaneous analysis of more than one target. Specific quantification of
multiple targets that are amplified within a reaction can be performed using a differentially
labeled primer or probes. Amplicon or probe melting curve analysis allows multiplexing in
allelic discrimination if a dsDNA-binding dye is used as the detection chemistry.
Normalization: A control gene that is expressed at a constant level is used to normalize the
gene expression results for variable template amount or template quality. If RNA quantitation
can be done accurately, normalization might be done using total RNA amount used in the
reaction. The use of multiple housekeeping genes that are most appropriate for the target cell
or tissue is the most optimal means for normalization.
Nucleic acid sequence based amplification (NASBA): NASBA is an isothermal nucleic acid
amplification procedure based on target-specific primers and probes, and the co-ordinated
activity of THREE enzymes: AMV reverse transcriptase, RNase H and T7 RNA polymerase.
NASBA allows direct detection of viral RNA by nucleic acid amplification.
No amplification control (NAC, a minus enzyme control): In mRNA analysis, NAC is a
mock reverse transcription containing all the RT-PCR reagents, except the reverse
transcriptase. If cDNA or genomic DNA is used as a template, a reaction mixture lacking
Taq polymerase can be included in the assay as NAC. No product should be synthesized
in the NTC or NAC. If the absolute fluorescence of the NAC is greater than that of the
NTC after PCR, fluorescent contaminants may be present in the sample or in the heating
block of the thermal cycler.
No template control (NTC, a minus sample control): NTC includes all of the RT-PCR
reagents except the RNA template. No product should be synthesized in the NTC or NAC; if
a product is amplified, this indicates contamination (fluorescent or PCR products) or
presence of genomic DNA in the RNA sample.
Normalized amount of target: A unitless number that can be used to compare the relative
amount of target in different samples.
Nucleic acid target (also called ‘target template’): DNA or RNA sequence that is going to be
amplified.
Passive reference: A dye that provides an internal reference to which the reporter dye signal
can be normalized during data analysis. Normalization is necessary to correct for fluctuations
from well to well caused by changes in concentration or volume. ROX is the most commonly
used passive reference dye.
Quencher: The molecule that absorbs the emission of fluorescent reporter when in close
vicinity. Most commonly used quenchers include 6-carboxy-tetra-methyl-rhodamine
(TAMRA), (DABCYL) and black hole quencher (BHQ).
R: In illustrations of real-time PCR principles, R represents fluorescent reporter (fluorochrome).
r coefficient: Correlation coefficient, which is used to analyze a standard curve (ten-fold
dilutions plotted against Ct values) obtained by linear regression analysis. It should be ≥0.99
for gene quantitation analysis. It takes values between zero and –1 for negative correlation
and between zero and +1 for positive correlations.
Glossary xxiii
R2 coefficient: Frequently mixed up with ‘r’ but this is R-squared (also called coefficient of
determination). This coefficient only takes values between zero and +1. R2 is used to assess the
fit of the standard curve to the data points plotted. The closer the value to 1, the better the fit.
Rapid-cycle PCR: A powerful technique for nucleic acid amplification and analysis that is
completed in less than half an hour. Samples amplified by rapid-cycle PCR are immediately
analyzed by melting curve analysis in the same instrument. In the presence of fluorescent
hybridization probes, melting curves provide ‘dynamic dot blots’ for fine sequence analysis,
including single nucleotide polymorphism (SNPs). Leading instruments that perform rapid-
cycle PCR are RapidCycler®2 (Idaho Technology) and LightCycler® (Roche).
Real-time PCR: The continuous collection of fluorescent signal from polymerase chain
reaction throughout cycles.
Reference: A passive or active signal used to normalize experimental results. Endogenous and
exogenous controls are examples of active references. Active reference means the signal is
generated as the result of PCR amplification.
Reference dye: Used in all reactions to obtain normalized reporter signal (Rn) adjusted for
well-to-well variations by the analysis software. The most common reference dye is ROX and
is usually included in the master mix.
Reporter dye (fluorophore): The fluorescent dye used to monitor amplicon accumulation.
This can be attached to a specific probe or can be a dsDNA binding agent.
Relative quantification: A relative quantification assay is used to analyze changes in gene
expression in a given sample relative to another reference sample (such as relative increase or
decrease, compared to the baseline level, in gene expression in response to a treatment or in
time, etc). Includes comparative Ct (ΔΔCt) and relative-fold methods.
Ribosomal RNA (rRNA): Commonly used as a normalizer in quantitative real-time RNA. It is
not considered ideal due to its expression levels, transcription by a different RNA polymerase
and possible imbalances in relative rRNA-to-mRNA content in different cell types.
Rn (normalized reporter signal): The fluorescence emission intensity of the reporter dye
divided by the fluorescence emission intensity of the passive reference dye. Rn+ is the Rn
value of a reaction containing all components, including the template and Rn is the Rn value
of an unreacted sample. The Rn value can be obtained from the early cycles of a real-time PCR
run (those cycles prior to a significant increase in fluorescence), or a reaction that does not
contain any template.
ΔRn (delta Rn, dRn): The magnitude of the signal generated during the PCR at each time
point. The ΔRn value is determined by the following formula: (Rn+) – (Rn).
ROX (6-carboxy-X-rhodamine): Most commonly used passive reference dye for normaliza-
tion of reporter signal.
Scorpion: Another fluorescence detection system consists of a detection probe with the
upstream primer with a fluorophore at the 5’ end, followed by a complementary stem-loop
structure also containing the specific probe sequence, quencher dye and a PCR primer on the
3’ end. This structure makes the sequence-specific priming and probing a unimolecular event
which creates enough specificity for allelic discrimination assays.
Slope: Mathematically calculated slope of standard curve, e.g., the plot of Ct values against
logarithm of ten-fold dilutions of target nucleic acid. This slope is used for efficiency calcula-
tion. Ideally, the slope should be 3.3 (3.1 to 3.6), which corresponds to 100% efficiency
xxiv Glossary
(precisely 1.0092) or two-fold (precisely, 2.0092) amplification at each cycle. Also called
gradient.
Standard: A sample of known concentration used to construct a standard curve. By running
standards of varying concentrations, a standard curve is created from which the quantity of
an unknown sample can be calculated.
Standard curve: Obtained by plotting Ct values against log-transformed concentrations of
serial ten-fold dilutions of the target nucleic acid. Standard curve is obtained for quantitative
PCR and the range of concentrations included should cover the expected unknown concen-
trations range.
Sunrise™ primers: Created by Oncor, Sunrise™ primers are similar to molecular beacons.
They are self-complementary primers which dissociate through the synthesis of the comple-
mentary strand and produce fluorescence signals.
TAMRA (6-carboxy-tetra-methyl-rhodamine): Most commonly used quencher at the 3’ end
of a TaqMan® probe.
TaqMan® probe: A dual-labeled specific hydrolysis probe designed to bind to a target
sequence with a fluorescent reporter dye at one end and a quencher at the other.
Threshold: Usually 10X the standard deviation of Rn for the early PCR cycles (baseline). The
threshold should be set in the region associated with an exponential growth of PCR product.
It is the numerical value assigned for each run to calculate the Ct value for each amplification.
Unknown: A sample containing an unknown quantity of template. This is the sample of
interest whose quantity is being determined.
Links to software and web
resources cited
geNORM (download)
http://medgen.ugent.be/~jvdesomp/genorm
qBASE (download)
http://medgen.ugent.be/qbase
DART (download)
http://nar.oxfordjournals.org/cgi/content/full/31/14/e73/DC1
REST (download)
http://www.gene-quantification.de/rest.html
Best Keeper (download)
http://www.gene-quantification.de/bestkeeper.html
Mfold (nucleic acid folding and hybridization prediction)
http://www.bioinfo.rpi.edu/applications/mfold
Exiqon OligoDesign (LNA Primers)
http://lnatools.com
D-LUX Designer
http://orf.invitrogen.com/lux
PrimerBank
http://pga.mgh.harvard.edu/primerbank
RTPprimerDB
http://medgen.ugent.be/rtprimerdb
Quantitative PCR Primer Database (QPPD)
http://web.ncifcrf.gov/rtp/GEL/primerdb
Human Genome Project Database
http://genome.ucsc.edu/cgi-bin/hgGateway?org=human
NCBI Entrez GENE (Replaced Locus Link)
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene
NCBI Blast
http://www.ncbi.nlm.nih.gov/blast
xxvi Links to software and web resources cited
MITOMAP (Human Mitochondrial Genome Database)
http://www.mitomap.org
TATAA Biocenter
www.tataa.com
Gene Quantification Web Resources
http://www.gene-quantification.info
An introduction to
real-time PCR
Gregory L. Shipley
1
1.1 Introduction
There are several ways to interrogate a cell for changes induced by artificial
or natural agents during a biological process. One way is to look for changes
in cellular transcript levels that may indicate changes in the corresponding
proteins. In another instance, the focus may be on the presence or absence
of a viral or bacterial pathogen. In this case, detecting not only the presence
but also the level of the pathogen provides valuable information in devising
a treatment regimen. Alternatively, looking for an increase in the level of
expression from a transgene or the inhibition of expression of an endoge-
nous gene by an siRNA may be the question of interest. In all cases, quanti-
tative real-time PCR technology can be utilized to provide the required
information. Successful implementation of the technology requires users to
have a basic background in the theoretical principles of real-time PCR as
well as their practical application to the project at hand. The goal of this
introductory chapter is to provide a basic foundation in the use of real-time
PCR. Some of the following chapters will expand on topics presented here
and add necessary new information required for a full understanding of this
powerful technique.
1.2 A brief history of nucleic acid detection and
quantification
Initially, nucleic acid quantification meant the addition of radiolabeled
UTP or deoxythymidine triphosphate (dTTP) to cell cultures or one of many
possible in vitro experimental preparations and measuring their incorpora-
tion into nucleic acids by TCA (trichoroacetic acid) precipitation. Although
radioactive incorporation is a quantitative technique and gave the investi-
gator an idea of the global changes in the nucleic acid population of their
experimental system, it was not satisfactory for identifying or quantifying
specific genes or transcripts. The first breakthrough in the identification of
specific genes came with the development of the Southern transfer method
(Southern, 1975). This was followed by the Northern blot for RNA (Alwine
et al., 1977). In both cases, it was now possible to specifically identify a
particular gene or transcript by hybridization of a radioactively labeled
probe to a membrane bearing DNA restriction fragments or RNA. Neither of
these methods were quantitative techniques despite the best efforts to
extract quantitative information from their use.
2 Real-time PCR
The next improvement in RNA transcript quantification came with the
RNase-protection experiment. In this method, a short (<500 bases) highly
radioactive anti-sense RNA was made from a plasmid construct utilizing T7
RNA polymerase. In vitro transcribed RNA was synthesized for the
transcript(s) of interest along with a probe used for loading normalization.
The radioactive anti-sense probes were then combined with each total RNA
sample and hybridized to completion in liquid. The resulting double-
stranded RNA product(s) were protected from the subsequent addition of a
cocktail of single strand-specific nucleases. The protected products were
then separated on a gel via denaturing polyacrylamide gel electrophoresis
(PAGE) and exposed to film. This method had the advantage of hybridiza-
tion in liquid rather than a solid surface and did not require the transfer of
the RNAs to a membrane. However, the inherent short dynamic range
when using film was the same. Again, the phosphoimager improved greatly
on quantification for these experiments due to the expanded dynamic
range and improved software for analysis. The down side to RNase protec-
tion experiments was the probes had to have high radioactive specific activ-
ity and required great care for safety reasons.
The procedure for performing the polymerase chain reaction (PCR) was
first introduced by Kerry Mullis in 1983 (Mullis, 1990) for which he won the
Nobel Prize in 1993. It is hard to think of another laboratory technique that
has had a greater impact on so many different facets of biological research
than PCR. In combining the reverse transcriptase (RT) reaction with the
PCR, identification of a specific RNA transcript was now possible from very
low copy numbers of starting material. Quantification of transcripts from
sample unknowns became possible with the advent of competitive RT-PCR
(Vu et al., 2000). In this method, a truncated version of the target region of
interest lies between the same primer-binding sites as the target transcript
sequence within a plasmid clone. The easiest method for making a smaller
competitive target was to digest the cloned region between the primer-
binding sites with a restriction enzyme and then ligate the resulting sticky
ends, dropping out a short section of sequence. The requirements for the
quantification construct were that it be a similar, but different, size than the
target PCR product and quantified. The plasmid contains a T7, SP6 or T3
RNA promoter sequence up stream of the cloned target sequence. Utilizing
the RNA promoter, truncated in vitro transcribed RNA could be made and
quantified. Known amounts of the RNA product were spiked into the RT
reaction and converted into cDNA along with the target sequence within
the unknown sample. Subsequently, both the truncated standard and
unknown target sequences were amplified using the PCR. The amplified
DNAs were separated using denaturing polyacrylamide gel electrophoresis.
In some methods a radioactive deoxynucleotide base was added for labeling
the amplified DNA and quantified using either film or a phosphoimager. In
other methods, the products on the gel were imaged following staining
with ethidium bromide or SYBR® Green I. Quantification of the unknown
target band was determined by comparison to signal from the spiked and
quantified DNA standard. Although this method was the most accurate to
date it still suffered from the detection problems mentioned earlier.
However, most of the criticism centered around the spiked DNA standard.
The concern was that the DNA standard was competing for reagent
An introduction to real-time PCR 3
resources and primers with the unknown target during the PCR and might,
therefore, alter the final result.
In 1996, Applied Biosystems (ABI) made real-time PCR commercially
available (Heid et al., 1996) with the introduction of the 7700 instrument.
Real-time quantitative PCR has become the most accurate and sensitive
method for the detection and quantification of nucleic acids yet devised.
This method has overcome most of the major shortcomings of the preced-
ing ones. Using the specificity and sensitivity of PCR combined with direct
detection of the target of choice utilizing fluorescently labeled primers,
probes or dyes, the inherent problems of gels, transfer to a membrane,
radioactive probe hybridization and the limitations of film as a detector
have been eliminated. There are two problems for real-time PCR that still
linger. They are 1) methods of quantification, i.e. kind of standard, assay
quality and calculation methodology used and 2) how to properly normal-
ize different samples to correct for differences in nucleic acid input from
sample to sample. Both of these areas are the topic of much study and will
be discussed in more detail in following chapters.
1.3 Real-time quantitative PCR – a definition
What exactly is real-time quantitative PCR? Some believe you have to be
able to watch the growth of the amplification curves during the PCR on a
computer monitor in order to be truly ‘real-time’. This of course is not the
case. The ABI 7700 SDS software, the original real-time program, does not
allow the visualization of the amplification curves as they progress through-
out the run. This was primarily due to the way the SDS software performs
data analysis utilizing the final data set from the whole plate rather than
analyzing each reaction individually. Thus for some instruments, the final
data have to be present for data analysis to proceed. For other instruments,
it does not. The latter case allows the software to follow the progress of the
amplification curve in each well in real time, which can be visualized on the
computer monitor. This ability does not make these instruments exclu-
sively ‘real-time instruments’.
Thus, real-time PCR is the continuous collection of fluorescent signal
from one or more polymerase chain reactions over a range of cycles.
Quantitative real-time PCR is the conversion of the fluorescent signals from
each reaction into a numerical value for each sample.
1.4 Practical and theoretical principles underlying
real-time PCR
RNA quantification begins with the making of cDNA (complementary
DNA) by reverse transcriptase. There are two kinds of RT enzymes readily
available on the market, AMV (Peters et al., 2004) and MMLV (Gerard et al.,
1997). AMV is a dimeric protein from the avian myeloblastosis virus. MMLV
is derived from the Moloney murine leukemia virus and is a monomeric
protein. Both enzymes have RNase H activity, which is the ability to
degrade RNA in an RNA–DNA hybrid. However, AMVs have higher RNase H
activity compared to MMLV enzymes. In both enzymes, the RNase H
activity can be separated from the RNA-dependent DNA polymerase activity
4 Real-time PCR
by mutagenesis. More importantly, AMVs are more processive than MMLV
enzymes. That is, they can incorporate more nucleotides per unit enzyme
per template molecule. The temperature optimum for the native AMV
enzyme is higher than that for MMLVs; 42˚C versus 37˚C. Cloned variants
of both enzymes have pushed the temperature limits much higher: 58˚C for
AMVs and 55˚C for MMLV modified enzymes. From this description, you
most likely would deduce that engineered AMV enzymes would be best
suited for making cDNAs from RNA samples prior to real-time PCR.
However, in practice it is the engineered MMLVs that work best for this
purpose. It is not clear why this is true but it has been proposed that
although the high temperature of the PCR kills the polymerase activity of
both reverse transcriptases, the DNA binding capability remains and may
present a physical barrier to Taq polymerase during the PCR. The higher
temperature stability and dimeric nature of AMV may be the reason it is less
suited for use in real-time PCR. A comparison of the most commonly used
reverse transcriptase enzymes is given in Table 1.1 kindly prepared by Dr.
Duncan Clark, GeneSys Ltd.
Both of these enzymes have been shown to be inhibitory to PCR in a
concentration dependent manner. For this reason it is important to keep
the amount of reverse transcriptase as low as possible while still achieving
optimal cDNA synthesis. In practice, less reverse transcriptase is required for
assay-specific primers than for assays primed by either oligo-dT or random
primers because the total amount and complexity of the cDNA made is
much reduced. It should be pointed out that cDNA will still be made even
if no primers are added to the reverse transcriptase reaction. This is caused
by self-priming due to secondary structure within the RNA template.
There are three ways to prime a reverse transcriptase reaction: oligo-dT,
random primers or assay-specific primers (Winer et al., 1999; Calogero et al.,
2000). There are pros and cons for each type and in the end, the best choice
turns out to be tied to the format of the subsequent PCR. Oligo-dT has been
used extensively because it will prime primarily mRNAs. However, not all
messenger RNAs have poly-A tails and there are poly-A tracts within some
RNA sequences. The largest problem with oligo-dT priming is that it limits
the selection of the following PCR assay to a region near the poly-A tail of
the mRNA. For transcripts that are very long, some are over 15 Kb in length,
the assay has to be placed within the 3’ UTR (3’ untranslated region) of the
transcript. Although this will result in high transcript fidelity for the target
of interest, it means that the assay most likely will not cross an exon/exon
junction. For some transcripts, the 3’ UTR sequence can be very A/T rich
and thus not very conducive for the design of a PCR assay. The use of
random primers removes the 3’ UTR bias as cDNA is made throughout the
transcript sequence. However, random primers will also make cDNA from
ribosomal and transfer RNAs, which makes a much more abundant and
complex cDNA population thus increasing the risk of false priming during
the PCR. Further, it is possible that priming will be initiated within the PCR
amplicon (the sequence amplified during PCR) by one of the random
primers, eliminating that molecule from possible detection. A third alterna-
tive is the use of assay-specific primers. In this case, the reverse primer for
the following PCR is used to prime cDNA synthesis in the reverse transcrip-
tase reaction. This ensures, in theory, that every potential transcript
Table 1.1 Commonly used reverse transcriptases
MMLV MMLV RNaseH- MMLV RNaseH- MMLV RNaseH- AMV Tth
(equivalent to (equivalent to (equivalent to
Superscript I) Superscript II) Superscript III)
Organism Moloney Moloney Moloney Moloney Avian Thermus
Murine Murine Murine Murine myeloblastosis thermophilus
Leukemia virus Leukemia virus Leukemia virus Leukemia virus virus HB8
Molecular weight 75 kDa 56 kDa 75 kDa 75 kDa 63 kDa + 95 kDa 94 kDa
Number of 671 503 671 671 544 + 859 832
amino acids
Single chain or Single Single Single Single Two Single
subunits 63 kDa alpha chain and
95 kDa beta chain –
heterodimer
Extension rate 2 kb–4 kb/min 2 kb–4 kb/min 2 kb–4 kb/min 2 kb–4 kb/min
RNaseH activity Yes No (C-terminal No (single No (single Yes, strong Yes, low
deletion of full point mutation) point mutation)
length enzyme)
Half life at 37°C 435 mins – 390 mins >435 mins 110 mins –
(minus template
primer)
Half life at 50°C 3 mins – 6 mins 220 mins 2 mins 20 mins at 95ºC
(minus template
primer)
Half life at 50°C 3 mins – 10 mins – 15 mins –
(plus template
primer)
An introduction to real-time PCR 5
6 Real-time PCR
targeted by the PCR assay will have a corresponding cDNA synthesized.
Further, the length of each cDNA has only to be the length of the amplicon.
For any real-time PCR assay, the maximal length of the amplicon should be,
at most 250 bases long.
From the previous discussion, the use of assay-specific primers would
appear to be the best choice, and it is for many applications. However, the
use of assay-specific primers has two main drawbacks. First it uses more
sample RNA as only one assay can be run from each cDNA reaction and
second, it cannot be used if a multiplex (more than one real-time assay run
in the same PCR) reaction is contemplated. Therefore, the appropriate
priming method must be determined by the investigator based on the
amount of template available and the kind of real-time assay that is
planned.
The business end of real-time PCR detection is, of course, the polymerase
chain reaction. The heart of the modern PCR is the addition of a
thermostable DNA polymerase. The most commonly used enzyme is from
Thermus aquaticus or Taq. Wild type Taq is a 5’–3’ synthetic DNA-dependent
DNA polymerase with 3’–5’ proof reading activity. It also has 5’-nuclease
activity. Although wild-type Taq can be purchased commercially, the
enzyme most commonly used for real-time PCR is a cloned version of
the enzyme that has been mutated to remove the 3’–5’ proof reading
activity. Taq is a DNA-dependent DNA polymerase and is a very processive
enzyme compared to other commercially available thermostable DNA-
dependent DNA polymerases, which accounts for its popularity for use in
real-time PCR. Table 1.2, kindly supplied by Dr Duncan Clark, GeneSys Ltd.,
lists comparative information for the most commonly used thermostable
DNA polymerases for real-time qPCR (quantitative PCR) as well as Pfu from
Pyrococcus furiousus used for standard PCR applications as a reference. The
list is not intended to be totally inclusive of all available thermostable DNA
polymerases.
There are two versions of Taq commercially available, the engineered
polymerase and a hot-start enzyme. Hot-start enzymes may have added
components that keep the polymerase from working until they are inacti-
vated at a high temperature over a period of 1–15 minutes. Common
additives are either one or more antibodies directed against the active site of
the polymerase or one or more heat labile small molecules that block
polymerase activity. Also, there are enzymes with an engineered
mutation(s) that requires heating for enzymatic activation. Hot-start
enzyme activation is accomplished by the high temperature (94˚–95˚C) of
the first denaturing step in the PCR cycle. The difference among them is in
how long the enzyme must stay at the high temperature for significant
enzymatic activation to occur.
A hot-start enzyme is important for some PCRs as most, if not all, the false
priming occurs within the first cycle while the components are being
heated past the annealing temperature for the first time. Until the reaction
mixture reaches the lowest temperature of the thermocycling program,
usually 55˚ to 60˚C, primers can bind and prime new strand synthesis more
easily from the incorrect sequence causing false priming. Once a primer has
initiated false priming, the sequence of the primer is incorporated into the
rogue sequence. Should the other primer also manage to false prime from
Table 1.2 Commonly used DNA polymerases for PCR
Taq DNA polymerase Tth DNA polymerase Stoffel fragment KlenTaq fragment Pfu DNA polymerase
Organism Thermus Thermus Thermus Thermus Pyrococcus
aquaticus YT1 thermophilus HB8 aquaticus YT1 aquaticus YT1 furiosus
Molecular weight 94 kDa 94 kDa 61 kDa 63 kDa 90 kDa
Number of amino acids 832 832 544 555 775
Single chain or subunits Single Single Single Single Single
Extension rate 2 kb–4 kb/min 2 kb–4 kb/min 2 kb–4 kb/min 2 kb–4 kb/min 1 kb–2 kb/min
Reverse transcriptase Minimal/low Yes, Mn2+ dependent Minimal/low Minimal/low No
activity
Half life @ 95ºC 40 mins 20 mins 80 mins 80 mins >4 hrs
Processivity 50–60 bases 30–40 bases 5–10 bases 5–10 bases 15–25 bases
5’–3’ exonuclease Yes Yes No No No
activity
3’–5’ exonuclease No No No No Yes
activity
Incorporates dUTP Yes Yes Yes Yes No
Extra A addition Yes Yes Yes Yes No
An introduction to real-time PCR 7
8 Real-time PCR
Real versus ideal amplification
7.0 x 1009
䉬
6.0 x 1009
5.0 x 1009
Molecules 4.0 x 1009 䊉 䊉䊉 䊉 䊉䊉 䊉䊉 䊉䊉 䊉䊉 䊉
䉬 䊉
3.0 x 1009
䊉
2.0 x 1009
䉬
䊉
1.0 x 1009 䊉
䉬
䉬
0.0 䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬䉬 䉬 䉬
0 10 20 30 40
Cycle no.
Figure 1.1
Graphical representation of the fluorescent signals from an ideal verses an actual
reaction over 40 cycles of real-time PCR. In an ideal PCR, there are two phases:
a baseline where the signal is below the level of instrument detection followed
by a persistent geometric increase in fluorescence that continues over the
remaining cycles of the experiment. However in an actual PCR, there are four
phases. As in the ideal reaction, there is a baseline followed by a geometric
phase. However, the amplification becomes less than ideal leading to a linear
phase and finally a plateau where no further increase in signal occurs over the
remaining signals. 䉬 – Ideal PCR, 䊉 – Simulated real amplification curve.
the rogue sequence, an unintended PCR product will result as both primer
sequences have been incorporated into the PCR product. However, if the
DNA polymerase is not active when the reaction is first heating, there will
be no opportunity for false priming to occur at that time. This does not
mean that there will never be false priming with hot-start enzymes but it
will greatly reduce the number of falsely amplified products. Hot-start
enzymes are important when the complexity of the DNA or cDNA popula-
tion being amplified is very high. Examples are genomic DNA or cDNA
made from oligo-dT or random primers. Members of our laboratory have
empirically shown that cDNA made from assay-specific primers does not
require a hot-start Taq.
Initially, the running of an RT-PCR or PCR experiment was akin to a black
box. Reagents were put into a tube with the template, run using the appro-
priate program on a thermocycler and, if everything went well, a band
would appear at the appropriate place on a gel following electrophoresis, at
the size of the expected PCR product. With the advent of real-time PCR, it
has become possible to look into the tube during the process and ‘see’ what
is happening to the template as it is amplified through multiple PCR cycles.
As a result, we have learned a lot about how the reactants, templates and
primers affect the final outcome.
An introduction to real-time PCR 9
4.000
3.500
3.000
2.500
2.000
DRn
1.500
1.000
0.500
0.000
–0.500
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycle
Figure 1.2
Sample dilution series of an oligonucleotide standard over a 7-log range, from a
real-time PCR experiment. Each amplification curve illustrates the four phases of
a polymerase chain reaction experiment: baseline, signal being made but not
detectable by the instrument; geometric, detectable signal with maximal PCR
efficiency; linear, post-geometric with slowly declining PCR efficiency; and
plateau, no or very little new product made.
Prior to embarking on a real-time experiment, it is useful to acquire an
understanding of the basic principles underlying the polymerase chain
reaction. The amplification of any template is defined by four phases: 1 –
baseline; 2 – exponential; 3 – linear and 4 – plateau. The baseline phase
contains all the amplification that is below the level of detection of the real-
time instrument. Although there is no detectible signal, exponential ampli-
fication of the template is occurring during these cycles. The exponential
phase is comprised of the earliest detectible signal from a polymerase chain
reaction where the amplification is proceeding at its maximal exponential
rate. The length of this phase depends on the template concentration and
the quality of the real-time assay. In an ideal reaction there are 2 complete
molecules synthesized from every one template available in the exponential
phase. This is the definition of an assay that is 100% efficient. In the linear
phase, the amplification efficiency begins to taper off. Figure 1.1 shows an
ideal amplification curve that remains at 100% efficiency versus a more
realistic one showing a linear and plateau phase. As can be seen, the linear
phase is also a straight line but amplification is no longer 2 products from
every 1 template molecule in each cycle but rather degrades to 1.95 from 1
and gradually declines in template replication efficiency further until the
fourth phase, the plateau, is reached where amplification rapidly ceases for
the remaining cycles of the experiment. Figure 1.2 shows the amplification
curves for a real-time PCR assay over a 7-log dilution series of synthetic
10 Real-time PCR
oligonucleotide DNA template. Note that all the curves are parallel to one
another showing that the amplification for each template dilution has the
same kinetics. The four phases of amplification can clearly be seen within
each individual curve.
It is not clear why the PCR goes through the linear and plateau phases.
There are more than adequate reactants to sustain the PCR at an ideal rate
for many more cycles than are typically seen in a 40 cycle experiment.
There has been speculation in that there are ‘toxic’ products built up after
so many cycles and these lead to a decline and cessation of product ampli-
fication. It is more likely that the highly amplified product concentration in
the reaction favors association over dissociation and the denaturation of
the DNA polymerase over a large number of cycles both lead to a slow down
and eventual cessation of amplification. An alternative to exponential
amplification, LATE PCR (linear after the exponential PCR) (Sanchez et al.,
2004; Pierce et al., 2005), adds one primer at a reduced concentration, but
comparable Tm, compared to the other primer so that the PCR proceeds at
an exponential rate until it reaches a detectable level. The reaction then
runs out of one primer and proceeds by copying one strand only each cycle
using the remaining primer. This is called linear amplification. By slowing
the reaction to a linear amplification, the occurrence of the plateau phase is
greatly delayed to non-existent.
It is worth taking a moment to discuss what happens during the first two
cycles of any PCR. If the template is cDNA or a single stranded DNA oligo,
the first cycle of the PCR will make every molecule at least partially double
stranded, depending on the length of the template and the length of time
in the cycle for DNA synthesis. The main point is there is no amplification
occurring during the first PCR cycle in this case. On the other hand, if the
template is double stranded, like genomic DNA or a double-stranded DNA
viral genome, amplification will commence during the first cycle, as both
primers will have a template for synthesis. This is particularly important to
keep in mind if one is using a double-stranded standard to quantify a single-
stranded cDNA template.
All the real-time instruments on the market today are based on the detec-
tion of a fluorescent signal. The increase in fluorescence is directly propor-
tional to the increase in the amplified product during the PCR. Fluorescent
molecules absorb light as photons within a narrow wavelength range of
light. The wavelength at which the dye absorbs light maximally is called the
excitation wavelength for that molecule. Following excitation, the mole-
cule is pushed to a higher energy state. This higher energy state is transient
and short lived. The excited molecule rapidly decays, falling back to the
ground energy state. When this occurs a photon of light is emitted at a
longer wavelength. The light that is released is at the emission wavelength.
This shift between the excitation and emission wavelengths is called a
Stoke’s shift (Lakowicz, 1983). For every fluorescent dye, there is an optimal
excitation and emission wavelength. A fluorescent molecule can be excited
or detected in a narrow range of wavelengths around these optima.
Fluorescent molecules with the greatest Stoke’s shift are the most desirable
as they allow the cleanest separation of the excitation from the emitted
wavelengths of light.
A major requirement for any fluorescent assay is that the initial and final
An introduction to real-time PCR 11
signal intensities have as large a difference as possible. This is called the
assay delta. All fluorescent assays used for real-time PCR achieve this delta
by utilizing FRET (fluorescence resonance energy transfer) (Selvin, 1995).
FRET requires two molecules that can interact with one another, at least one
of which must be capable of fluorescence. The fluorescent component is
called the donor and the second molecule is called the acceptor. During
FRET, the donor fluorescent dye is excited by an external light source at or
near its optimal excitation wavelength and then emits light at a shifted,
longer wavelength (Stoke’s shift), as described above. Instead of being
detected by the instrument, the emitted light is used to excite an acceptor
molecule, which is in close physical proximity. The acceptor molecule
absorbs the emitted light energy from the donor dye, effectively quenching
the donor signal. The wavelength emitted by the donor molecule must be
near the absorbance maximum of the acceptor molecule. The acceptor
molecule may or may not emit light. If light is emitted by the acceptor, it
will be further shifted and a longer wavelength from that emitted by the
donor. The acceptor signal will be detected by the real-time instrument, but
it will not be recorded as a reporter signal by the software. FRET depends on
the donor and acceptor molecules being in close proximity (10–100 Å) and
falls off with the sixth power base 10 of the distance between the two
molecules. The other major requirement is that the excitation wavelength
of the acceptor be close to the emitted wavelength of the acceptor dye
(Didenko, 2001). Some of the most common donor and acceptor (reporter
and quencher) dyes currently used in real-time PCR are listed in Table 1.3.
There are three classes of fluorescent molecules used in real-time PCR.
The three types are defined by their function within an assay. The first is the
donor dye and is usually called the reporter. The fluorescent signal from the
reporter is the one that is monitored during the course of the experiment.
Second, is the acceptor or quencher molecule and is responsible for the
initial quenching of the reporter signal. Last is the reference dye. The refer-
ence dye is common to all reactions, does not interact with the assay
components and is used to normalize the signal from well to well in
software.
In theory, any fluorescent dye can be a reporter in an assay. The one used
most commonly is 6-FAM (6-carboxy fluorescein). This dye is efficiently
excited at 488 nM, the wavelength produced by the argon-ion lasers of the
original ABI real-time instrument, the now retired 7700, and the current
ABI 7900. However, 6-FAM has remained the first choice for other instru-
ments as well because it can be easily conjugated to oligonucleotides and
gives a strong signal. Another reporter in wide use today is SYBR® Green I.
Unlike 6-FAM, SYBR® Green I is a free dye in the PCR and works by provid-
ing a dramatic increase in fluorescence when bound to double stranded
DNA. Examples of some of the many assay chemistries available for real-
time PCR will be discussed in Section 1.6.
Quencher molecules can be fluorescent dyes or any molecule that can
absorb light energy within the appropriate wavelength range. The original
quencher dye used with the 6-FAM reporter was TAMRA (6-carboxy-tetra-
methylrhodamine). When coupled to the ends of an oligonucleotide, the
FAM signal is effectively quenched by the close proximity of TAMRA, due to
oligo folding, while in solution. There are also dark dye quenchers that, as
12 Real-time PCR
the name implies, quench the reporter signal but emit no light. The first of
these was DABSYL (4-(dimethylamino)azobenzene-4’-sulfonyl chloride).
More recently, other dark quenchers have come onto the market. Biosearch
Technologies markets a series of black hole quenchers (BHQs); Integrated
DNA Technologies has two forms of Iowa Black, and Nanogen (formerly
Epoch Biosciences) uses its Eclipse dark quencher. It has long been recog-
nized that fluorescein dyes are quenched by guanidine residues. This is the
working principle behind the LUX system from Invitrogen (see below) and
why probes with fluorescein reporters should never begin with a G residue.
The purpose of a reference dye is to monitor the fluorescence signal from
each well and correct for any well-to-well differences in detection
efficiency within the instrument. This was particularly important for the
ABI 7700, which has a unique fiber optic cable delivering and receiving the
excitation and emitted light for each of the 96 wells. The mechanism of
sending and receiving light from the plate is quite different in the host of
real-time instruments available today. Many still use a reference dye to
ensure that the signal from each well of the plate is balanced during data
analysis. Depending on the light path used by the instrument and the
quality of the thermocycler used, there can be plate ‘edge effects’ which
will require well-to-well normalization. However, if the ‘edge effects’
become too pronounced, differences between outer and internal wells
cannot be normalized by a reference dye. The most common reference dye
is ROX (6-carboxy-X-rhodamine). ROX can be found as a short 6-
FAM/ROX FRET-based oligo (ABI), a free dye conjugated with glycine
(Invitrogen) or as a polyethylene glycol conjugate sold as Super-ROX
(Biosearch Technologies). ROX was initially used when 6-FAM was the sole
reporter dye. With multiplexing becoming more common, it should be
pointed out that ROX does not have to be the dye used for well-to-well
normalization as ROX emits light in the middle of the valuable red
spectrum. In theory, any dye with a unique spectral signature compared to
the ones in the assay could be used. However, it would have to be available
in a format that kept it in solution. The Bio-Rad instruments normalize the
signal using a second plate with a fluorescein dye prior to the real-time run
instead of an internal reference dye in the master mix on the experimental
plate.
1.5 Real-time PCR instrumentation – an overview
It would be impractical to present technical information for every real-time
instrument on the market today. However, it is important that users of real-
time instruments have a basic understanding of how their instruments
work and have some understanding of their physical capabilities and limita-
tions. There are three major components in any real-time instrument: 1) the
light source, which determines the range of reporter dyes the instrument is
capable of using; 2) the detection system, where the spectral range and
sensitivity of any assay will be determined; and 3) the thermocycling
mechanism, the determinant of the speed at which an assay can be run, the
uniformity of the temperature changes from sample to sample and the
number of samples that can be accommodated at any one time.
There are currently four different light sources available in real-time
An introduction to real-time PCR 13
instruments, argon-ion laser; LED (light emitting diode) lasers, quartz
halogen tungsten lamps and xenon lamps. Each of these different light
sources will determine the capabilities of the instruments that use them.
The argon-ion laser, now available solely in the ABI 7900, emits powerful
light primarily at 488 nm. For reporters such as 6-FAM, this is an ideal
excitation wavelength. However, as you move toward the red spectrum, the
excitation energy from a 488 nM light source will result in a weaker stimu-
lation of a reporter dye with maximal excitation above 500 nM with a
concomitant weaker emission signal. Weaker signals can limit the utility of
a reporter dye. The ABI 7900 captures the emitted reporter signal using a
CCD (charge-coupled device) camera and relies on software to parse out
multiple emitted wavelengths. The ABI 7900 utilizes a Peltier-based thermo-
cycler. There are currently 4-exchangable thermocycler blocks available for
96- and 384-well plates.
A single LED laser can be found in the LightCycler® 1 and LightCycler® 2
from Roche. Unlike classic lasers, LED lasers emit light within a 30–40 nM
spectral range. The energy output of these lasers is not as strong as the
argon-ion lasers but their energy use and generated heat are significantly
less with a lower cost per unit. Both LightCycler®, 1 and 2, use a single blue
LED laser as an excitation source. The LightCycler® have a number of
photodetection diodes, each of which is specific for an increasing and
narrow wavelength range of light. Unlike the plates used in the block-based
ABI 7900, the LightCycler® uses glass capillary tube reaction vessels with a
high surface to volume ratio. Coupled with the hot air driven thermocycler
system, these machines can complete a 40 cycle experiment in about 30
minutes compared to thermocycler/plate-based instruments times of
approximately 2 hours.
Currently, the most used light source for new instruments is a quartz
tungsten halogen lamp. These lamps are capable of emitting a steady beam
of light from 360 nM to over 1,000 nM. They are sometimes referred to as
‘white light’ sources as they emit light over the entire visible spectrum.
Unlike either of the laser light sources described above, two sets of excita-
tion and emission filters are required to select the desired wavelengths for
multiple reporter dyes. The number of filters available determines the level
of multiplexing the instrument can support. Some of these instruments use
a PMT (photomultiplier tube) and others a CCD camera for signal detection
depending upon how the light is captured from the plate.
One of the newest instruments coming onto the market, the Roche
LightCycler® 480, has a xenon lamp, which has a higher light intensity
compared to the quartz tungsten-halogen lamp and covers a similar spectral
range. This machine will have 5 excitation filters coupled to 6 emission
filters which will potentially allow 6 different assays in a single, multiplexed
reaction. This instrument will support both 96- and 384-well plates in a
Peltier-based thermocycler that is reported to have the most uniform
thermal characteristics of any instrument.
Table 1.4 provides a selected overview of some of the most important
features for the newest instruments available from the major real-time PCR
instrument vendors. The ABI 7700, the original real-time instrument, is also
listed for comparison.
Besides the hardware itself, the next most important component of a
14 Real-time PCR
Table 1.3 Dyes available for use in real-time PCR
Free dyes Max. ab (nM) Max. em (nM)
®
SYBR Green I 497 525
EvaGreen™ 497 525
BOXTO™ 515 552
Reporter dyes Max. ab (nM) Max. em (nM)
Pulsar® 650 460 650
Fluorescein™ 492 520
6-FAM 494 518
Alexa 488™ 495 519
JOE™ 520 548
TET™ 521 536
Cal Fluor Gold 540™ 522 544
Yakima Yellow™ 530 549
HEX™ 535 556
Cal Fluor Orange 560™ 538 559
VIC™ 538 554
Quasar® 570 548 566
Cy3™ 552 570
TAMRA™ 565 580
Cal Fluor Red 590™ 569 591
Redmond Red™ 579 595
ROX™ 580 605
Cal Fluor Red 635™ 618 637
LightCycler®640 625 640
Cy5™ 643 667
Quasar® 670 647 667
LightCycler®705 685 705
Dark dyes Max. ab (nM) Max. em (nM)
DABCYL 453 None
BHQ0™ 495 None
Eclipse™ 522 None
Iowa Black™ FQ 531 None
BHQ1™ 534 None
BHQ2™ 579 None
Iowa Black™ RQ 656 None
BHQ3™ 680 None
Pulsar, Cal Fluor, BHQ, Quasar and Pulsar are registered trademarks of Biosearch
Technologies; Alexa is a registered trademark of Molecular Probes/Invitrogen; Iowa Black is
a registered trademark of IDT; Redmond Red, Yakima Yellow and Eclipse are registered
trademarks of Nanogen; LightCycler®640 and LightCycler®705 are registered trademarks of
Roche; Evagreen is the registerd trademark of Biotium, Inc.
real-time instrument is the software package. This aspect of any real-time
instrument should not be overlooked. An instrument with good hardware
but a poor software package can diminish the overall user experience.
Although many software packages offer different levels of automated data
analysis, it should be pointed out that the results may not be as good as
manual manipulation of the baseline and threshold settings by the investi-
gator (see Chapter 2). Most programs offer ways to export the metadata into
a file that can be opened in Microsoft Excel® and the graphical views into
An introduction to real-time PCR 15
one or more common graphical formats. These exports can be very useful
for more extensive data analysis in other programs and for incorporating
data or graphics in either publications or presentations (see Chapters 2 and
3). For these reasons, it is important that the user explore all aspects of the
software to ensure they are getting the most out of the data obtained by
their real-time instruments.
The trends in real-time PCR instrumentation development have been in
three directions. First has been an evolution in fluorescent dye detection. In
the early years of real-time PCR, assays were run with one assay per reaction.
This was primarily because the hardware was geared to the excitation of 6-
FAM as a reporter. As more and more instruments came onto the market
with more extensive capabilities in their spectral sophistication, it has
become possible to excite a larger spectrum of reporters. Today, many
instruments offer 5 or 6 unique excitation/emission filter combinations. In
theory, this would allow up to 5 or 6 transcript or gene assays to be
measured within a single multiplexed reaction. The emitted light from each
reporter dye is physically isolated from the others by the filters as it is
collected. This minimizes spectral spill over which was a real problem with
the early instruments that relied entirely on software to differentiate signals
from different reporter dyes. Thus, the instrumentation is now equipped for
extensive assay multiplexing. The chemistry is just now starting to catch up
and will be discussed in the next section.
The second development in real-time instrumentation has been towards
faster cycling capabilities. For the Roche LightCycler® 1 and 2 and the
Corbett Rotorgene, fast cycling has always been a feature because samples
were not heated in a block thermocycler. However, these machines offered
less than 96 sample capacities per run cycle (Table 1.4). The manufacturers
of instruments with block thermocyclers are now offering faster cycling
times coupled to new assay chemistries. This trend will undoubtedly reduce
the time it takes to run each plate. A reduction in run times becomes more
critical for high throughput users and will most likely lead to further reduc-
tions in run times.
The third development is the increase in sample throughput. For some time
now, the ABI 7900 has been the only real-time instrument on the market
capable of running 384-well plates. With the announcement of the new
Roche LightCycler® 480, that will no longer be the case. The LightCycler® 480
will have the added advantage of offering true multiplexing capabilities for up
to 6 dyes in each reaction. Although 384-well plates may seem overkill for the
individual laboratory, for the pharmaceutical industry, even 384-well plates
cannot provide the desired throughput. For true high throughput screening,
1,536-well plates are now the standard. For research core laboratories that
utilize liquid handling robots to set up the reactions, however, 384-well plates
are well positioned to raise the throughput bar over individual laboratories
where 96-well plates have become the upper limit for hand pipetting.
The combination of multiplexed reactions, faster cycling times and
higher sample throughputs per run through the use of robotics mean that
the throughput potential of real-time PCR has been amplified at least 40-
fold from the original instruments. What the throughput upper limit for
real-time instrumentation will be is not clear at this time. What is clear is
that limit has not yet been achieved.
16 Real-time PCR
Table 1.4 A comparison of features for the most commonly used real-time instruments
Instrument/ ABI Prism® ABI Prism® ABI Prism® Bio-Rad Bio-Rad MJR
configuration 7700 7500 7900 iQ®5 Chromo 4™
Light source Argon laser Tungsten- Argon laser Tungsten- 4 LEDs
halogen halogen
Detector CCD camera CCD camera CCD camera CCD camera 4 photodiode
detectors
Scanning system 96 fiber Whole plate Scanning head Whole plate Scanning
optic cables by row photonics
shuttle
Excitation 488 nm 450–650 nm 488 nm 400–700 nm 450–650 nm
wavelengths (s)
Emission 500–650 nm 500–700 nm 500–660 nm 400–700 nm 515–730 nm
wavelengths
Multiplex 2 5 2 5 4
capability
(number)
Sample vessel 96-well plate 96-well plate 96/384-well 96-well plate 96-well plate
plates
Sample volume 25–100 μl 20–100 μl 20–100 μl/96 10–50 μl 20–100 μl
5–20 μl/384
Temperature 9600 Peltier Peltier Peltier-Joule Peltier
control Thermocycler Thermocycler Thermocycler Thermocycler
Sensitivity 9-logs 9-logs 9-logs 6-logs 10-logs
1.6 Detection chemistries used in real-time PCR
There are three basic methodologies commonly used in the detection of
RNA or DNA targets by real-time PCR and all of them utilize fluorescent
dyes. In each case, a low initial fluorescent signal is increased proportionally
during each succeeding PCR cycle in tandem with the exponential increase
in the DNA product(s) formed.
The simplest assay system involves the incorporation of a free dye into
the newly formed double-stranded DNA product. The most used dye for this
purpose in real-time PCR is SYBR® Green I (Molecular Probes/Invitrogen).
The background fluorescence from SYBR® Green I when in solution as a free
dye and stimulated by light of the appropriate wavelength is very low. The
same is true for single-stranded nucleic acids at the concentrations used for
real-time PCR. In contrast, as the double-stranded DNA product is formed,
SYBR® Green I binds to the minor groove of the double-stranded DNA. The
DNA-dye complex results in a dramatic increase in fluorescence output,
when properly illuminated, of roughly 2,000 times the initial, unbound,
An introduction to real-time PCR 17
Cepheid Corbett Eppendorf Roche Roche Stratagene Techne
SmartCycler® Rotor-Gene™ Mastercycler® LightCycler® 2 LightCycler® Mx®3005p Quantica™
realplex4 480
4 LEDs 4 LEDs 96 LEDs Blue LED Xenon lamp Tungsten- Tungsten-
halogen halogen
4 Silicon 4 PMTs 2 channel Photodiodes CCD camera PMT 4 PMTs
photo- PMTs
detectors
All wells Through tube 96 fiber Through tube Plate Whole plate
optic cables scanning
450–650 nm 470–625 nm 470 nm 480 nm 450–615 nm 350–635 nm 460–650 nm
500–650 nm 510–665 nm 520–605 nm 530–710 nm 500–670 nm 440–610 nm 500–710 nm
4 4 4 6 6 5 4
16 indepen- 36/72-well 96-well plate 32 Capillaries 96/384-well 96-well plate 96-well plate
dent wells rotors plates
25 and 100–200 μl 10–50 μl 10–20 μl/small 20–100 μl/96 25 μl 15–50 μl
100 μl 100 μl/large 5–20 μl/384
Solid state Forced air Peltier Heater & fan Peltier Modified 8-Peltier
heating/ heating/ Thermocycler for cooling Thermocycler Peltier
forced air cooling thermocycler
cooling
Not stated 12-logs 9-logs 9-logs 8-logs 10-logs 9-logs
fluorescent signal (Figure 1.3). This assay system has a very good signal to
noise ratio. The popularity of SYBR® Green I assays with real-time PCR users
is due to three factors: 1) low cost for the dye; 2) ease of assay development,
only a pair of primers is required; and 3) the same detection mechanism can
be used for every assay. The down side is that every double-stranded
molecule made in the reaction will generate a signal, such as primer dimers
or inappropriate PCR products. This fact puts a high premium on good
primer design and careful quality control during assay development. It also
means that a hot-start DNA polymerase is a must to lessen or eliminate
extra-assay signals. A new dye, EvaGreen™ (Biotium, Hayward, CA) has
been presented for use in real-time PCR. EvaGreen™ costs more than SYBR®
Green I but it is reported to show little PCR inhibition which can be a
problem with high concentrations of SYBR® Green I, substantially higher
fluorescence over SYBR® Green I, and greater stability at high temperatures.
Whether these characteristics will be enough to entice users away from
SYBR® Green I remains to be seen. A third new free dye, BOXTO (TATAA
Biocenter, Gothenburg, Sweden), has come onto the market. Unlike SYBR®
18 Real-time PCR
Denature
Anneal
Extend
Taq
Figure 1.3
Graphical representation of the incorporation of SYBR® Green I dye resulting in
an increase in fluorescent signal during the PCR. Free dye has very low
fluorescence and will not bind to single stranded or denatured DNA. During
primer annealing, a double-stranded structure is formed and SYBR® Green I dye
is bound resulting in a dramatic increase in fluorescent signal. During primer
extension by Taq DNA polymerase, the fluorescent signal increases
proportionally to the number of SYBR® Green I dye molecules bound per
double-stranded molecule. The process is repeated in each cycle with increasing
total fluorescence.
Green I or EvaGreen™, BOXTO is optimally excited and emits light at
higher wavelengths than SYBR® Green I or EvaGreen™. In principle then, it
could be used in the same reaction with a FAM conjugated probe for the
detection of primer-dimers or to perform a melt-curve on PCR products,
neither of which is possible with a probe-based assay. The most recent
additions to the DNA binding dye choices are LCGreen™ I and LCGreen™
PLUS (Idaho Technology, Salt Lake City, UT) and will be discussed in
An introduction to real-time PCR 19
Chapter 9. More details of the use of SYBR® Green I in real-time PCR can be
found in Chapter 8.
There are many quite different dye-primer based signaling systems available
for real-time PCR. They range from the very simple LUX™ (light upon exten-
sion, Invitrogen) primers to more complex externally and internally quenched
primers to the very complex structure of scorpion primers. It is beyond the
scope of this chapter to describe each of these primer-based systems (Bustin,
2004). The template specificity for the dye-primer-based assays is the same as
for SYBR® Green I. The exception to that rule is the scorpion primer, where the
signal generated by the primer is dependent on a complementary match with
sequence located within the PCR amplicon. Dye-primer-based assays do allow
for multiplexing which is not possible with SYBR® Green I, EvaGreen™ or
BOXTO and they do not require the design of another, intervening, fluores-
cently labeled probe (see probe-based assays below).
LUX™ primers contain a 4–6 base extension on the 5’ end of the primer
that is complementary to an internal sequence of the primer near the 3’
end. The extension overlaps the position of a fluorescein dye (FAM or JOE)
attached to a base near the 3’ end of the primer. The design of LUX™
primers initially was a somewhat hit or miss proposition. However, new
algorithms used by the program at the Invitrogen web site now make their
successful design more assured for the investigator. The reporter dye signal
is quenched when in close proximity to the double stranded stem formed
within the primer while in solution. Quenching of the fluorescein signal is
particularly efficient when in close proximity to guanidine residues. During
the first PCR cycle, the LUX™ primer is incorporated into a new strand. At
this time, the stem can still be in place. However, when a new complemen-
tary second strand is made, the stem and loop are made linear. This struc-
tural change results in an increase in fluorescent signal of as much as
10-fold over background (Figure 1.4).
Extended primer (dsDNA)
Single-stranded primer
Hairpin primer
Figure 1.4
Structure and mode of action of a LUX™ (light upon eXtension) fluorescently
labeled primer. LUX™ primers are inherently quenched due to a designed, short
self-complementary sequence added to the 5’ end of the primer. The
fluorescent moiety on the 3’ end of the primer is quenched in this confirmation.
Following the melting and subsequent annealing of the primer to the template,
the primer is made linear and is incorporated into the new DNA strand leading
to a significant, as much as ten-fold, increase in fluorescence.
20 Real-time PCR
N H N
O
G N Ribose
isoG N
N Ribose
H
H H
N N N N N
H O
H
N N O
H H N
C isoC
H
N O N N
Ribose H
Ribose
Figure 1.5
Structures of the natural guanidine and cytosine bases showing hydrogen
bonding compared with the hydrogen bonded iso-base structures. The iso-bases
will only base pair with themselves and not the natural dG and dC residues nor
dA, dT or dU. They are recognized as dNTPs and incorporated by DNA
polymerase along with natural DNA bases into newly synthesized DNA.
A new primer-based assay system that is just coming onto the market is
the Plexor system from Promega. The basis for this assay is the use of two
isomers of the bases cytodine and guanine, iso-C and iso-G (Figure 1.5)
(Sherrill et al., 2004). The iso-bases will only base pair with the complemen-
tary iso-base and DNA polymerases will only add an iso-base when the
cognate complementary iso-base is present in the existing sequence. One
primer is synthesized with a fluorescently labeled iso-C on the 5’ end. The
PCR master mix contains free iso-dGTP coupled to a dark quencher dye
(DABSYL). As each amplification cycle progresses, the fluorescent signal
from the free fluorescently tagged iso-C primers is progressively quenched
as the labeled primers are incorporated into the growing amplified PCR
products (Figure 1.6). The quenching is accomplished following the synthe-
sis of the complementary strand bearing the iso-G-dark dye. Thus, unlike all
of the preceding assays where the fluorescent signal goes up, in this assay
the reporter signal goes down with increasing PCR cycles. For this reason,
special software has been written to facilitate data analysis using the
exported raw data file formats from several real-time instruments. One
advantage of this system is the ability to multiplex a large number of assays
with only primers using a universal quencher (iso-dGTP-DABSYL). Like all
primer-based assay systems, the quality of the assay is completely depen-
dent on the specificity of the primers. Therefore, good assay (primer) design
will be critical for assay specificity. On the other hand, it may be easier to
multiplex five assays in a reaction without the complexity of five probe
sequences along with ten primer pairs. This new assay system will have to
be tried and put to the test by the real-time community to see if it will
become as ubiquitous as the SYBR® Green I and TaqMan® assays are now.
The third category of signaling systems for real-time PCR are those
involving a third, fluorescently labeled oligonucleotide located between the
primers called a probe. Unlike the two assay systems above that consist
An introduction to real-time PCR 21
Reporter
isoC
Reporter
isoC
?
Reporter
isoC
?
isoG +
Quencher
Reporter
isoC
isoG +
Quencher
Figure 1.6
Graphic illustrating the operating principle underlying the Plexor® real-time PCR
assay. One primer is labeled at the 5’ end with an iso-dC and a fluorescent
reporter dye. The primer binds to the complementary template and is extended.
In the next cycle, a complementary strand is made during the PCR, using a
second, unlabeled primer. An iso-dG-DABCYL (4-(dimethylamino)azobenzene-4′-
carboxylic acid) base, present in the PCR master mix along with the four natural
dNTPs, is incorporated as a complement to the iso-dC in the new strand, The
DABCYL dark dye, now physically very close to the reporter, quenches the signal
from the reporter dye.
solely of a pair of primers, probe-based assays have the added specificity of
an intervening third (or fourth, see below) oligo called the probe. This is
because the probe is the fluorescently labeled component of these assays. A
further advantage of a probe-based assay is extraneous signals from primer
dimers that will be detected by free dye or dye-primer-based assays are not
detected by probe-based assays. Extra-assay DNA products larger than
primer dimers will also not be detected. The only PCR amplicon that can be
22 Real-time PCR
h
Denature
h
Anneal
h
Taq Extend
Figure 1.7
Graphical illustration showing fluorescent signal generation from a TaqMan®
probe. When free in solution, the reporter fluorescent dye is quenched by a
second molecule using FRET. As the reaction cools toward the annealing
temperature, the probe binds to a complementary template sequence at a
higher temperature than the primer on the same strand. During primer
extension by Taq DNA polymerase, the probe is displaced and degraded by a 5’
nuclease present in Taq DNA polymerase. Release of the reporter dye from the
probe molecule and its proximity to the quencher dye allows the full signal of
the reporter dye to be realized.
detected by a probe-based assay are those to which the primers and the
probe are both able to bind simultaneously. There are five distinct probe-
based assay systems in use today, TaqMan® probes, Molecular Beacons®,
minor groove binding (MGB) probes, Locked nucleic acid (LNA) probes and
hybridization probes. In each case, multiple reporter dyes can be used with
a variety of quenchers (Table 1.3) to form efficient FRET pairs. Thus, there
are many opportunities for multiplexing with probe-based assays.
TaqMan® or hydrolysis probes are linear oligonucleotides that have
historically been labeled with a reporter on the 5’ end and a quencher on
the 3’ end, although the opposite orientation can and has been used. When
the reporter and quencher dyes are in close proximity in solution, the
An introduction to real-time PCR 23
reporter signal is quenched. The efficiency of the quench is determined by
the probe sequence which in turn determines how efficiently the ends of
the probe associate in solution. When the probe anneals to its complemen-
tary target sequence, the two dyes are maximally separated and the reporter
signal detected by the instrument. There are no good predictors in any
software program for how well a probe will be quenched in practice.
However, there is a direct and inverse correlation between probe length and
quenching efficiency. For this reason, TaqMan® probes are kept to less than
30 bases in length.
It is essential that the probe anneal to the target strand sequence prior to
the primers to ensure that signal can potentially be generated from every
newly synthesized amplicon. Taq DNA polymerase binds and begins to
extend the new strand very rapidly following primer binding. For this
reason, hydrolysis probes are designed to have a Tm 9–10˚C higher than
their matched primers. Hydrolysis probes depend on the 5’ nuclease activ-
ity of Taq DNA polymerase for their cleavage during new strand synthesis to
generate a fluorescent signal from the newly freed reporter dye (Figure 1.7).
The TaqMan® name comes from this hydrolysis step in an analogy to the
action of the old computer game character, Pacman. New thermal stable
DNA polymerases have been introduced from other genera of bacteria that
do not contain 5’ nucleotidase activity. They work well for PCR but cannot
cleave hydrolysis probes.
Molecular beacons are similar to TaqMan® probes in that they are labeled
on each end with reporter and quencher moieties and, like TaqMan®
probes, their Tm is higher than the primers used for the assay. Unlike
hydrolysis probes, molecular beacons do not depend upon probe cleavage
for signal generation. Molecular beacons have a 4–6 base self-complemen-
tary sequence extension on each end. Thus, in solution, the ends of molec-
ular beacons fold into a perfect stem structure bringing the reporter and
quencher dyes close together forming a close FRET association. The close
proximity of the two dyes leads to very efficient quenching of the reporter
signal. During the annealing step, the probe becomes unfolded, the two
dyes are separated and the reporter signal detected by the real-time instru-
ment (Figure 1.8).
A minor groove-binding (MGB) protein bearing probes are hydrolysis
probes with shorter lengths due to the MGB moiety. As the name implies,
an MGB molecule is added to one end of the nucleic acid sequence, which
increases the affinity and lowers the Tm requirements of the nucleic acid
portion of the probe. There are two companies that sell MGB probes.
Applied Biosystems sells a probe with the MGB component and quencher
on the 3’ end and the reporter on the 5’ end of the nucleic acid sequence,
similar to TaqMan® probes. Like TaqMan® probes, their MGB probes can be
hydrolyzed by Taq DNA polymerase. The second company making MGB
probes is Nanogen. They put the quencher and MGB component on the 5’
end and the reporter on the 3’ end of the probe. The MGB moiety effectively
blocks hydrolysis of these probes. Like molecular beacons, signal is gene-
rated during the annealing step in the thermocycle. MGB probes from
either company are used primarily for SNP (single nucleotide polymor-
phism) and allelic discrimination assays where high sensitivity to a single
base mismatch is required. They can also be used for transcript analysis,
24 Real-time PCR
h
h
Figure 1.8
Illustration showing the mechanism of signal generation for a molecular beacon
probe. Designed complementary sequences 4–6 bases in length at the 5’ and 3’
ends bring the terminally placed reporter and quencher dyes in very close
proximity in solution leading to a much reduced reporter signal via FRET.
Following the melting of the template and probe structures, probe molecules
anneal to complementary sequences within the template as the temperature is
lowered to the annealing set point, At this time, the molecular beacon is
completely linear on the template, fully separating the reporter and quencher
dyes and resulting in full reporter signal due to the loss of FRET. Unlike
TaqMan® probes, molecular beacons do not require hydrolysis for signal
generation.
particularly when the G/C content of the template is very low resulting in
TaqMan® probes longer than 30 bases.
LNA probes are hydrolysis probes that are much shorter due to the higher
binding affinity of locked nucleic acid bases to standard DNA (Goldenberg
et al., 2005). LNAs are bicyclic DNA (or RNA) analogues (Figure 1.9). For this
reason, LNA-based probes need to be only 8–9 bases long to achieve a Tm of
68–69˚C under standard assay conditions. The most extensive use of LNA
probes currently is by Exiqon. It has been able to take advantage of the
redundancy of nanomeric sequences in the genome to design a relatively
small number of LNA probes that can be used by the investigator to design
An introduction to real-time PCR 25
HO Base Base
HO
O O
OH
O
OH
Locked nucleic acid Deoxynucleic acid
Figure 1.9
The deoxyribose ring structures of locked nucleic acids (LNAs) versus the natural
bases. The Tm values for oligonucleotides with LNA bases are much higher
versus those with natural bases alone.
a real-time PCR assay for every gene in many different genomes, using their
web-based software. For the human genome, a set of 90 LNA probes is suffi-
cient for complete coverage of the known transcriptome. LNA probes, due
to their short length, can be used effectively in SNP and allelic discrimina-
tion assays as well.
Unlike the other probe-based assays described above, hybridization
probes consist of two oligonucleotides that anneal between the primers,
each with a single fluorescent dye. This probe system uses FRET to generate,
rather than to quench, the fluorescent signal. The more 5’ probe oligo,
closer to the forward primer sequence, has a donor dye on the 3’ end and
the second probe molecule has an acceptor dye on the 5’ end. When the
probes anneal, the two dyes are brought into close proximity to one
another, only 1–3 bases apart. The detector dye (a fluorescein dye) absorbs
energy from the light source and the resulting emitted energy is transferred
to the second dye (a rhodamine dye) by FRET. It is the emitted signal from
the acceptor dye that is detected by the real-time instrument and recorded
(Figure 1.10). Hybridization probes were designed for and are used primarily
in the first Roche LightCycler® although they are not limited to those
instruments. This assay system works well but has the drawback of requiring
an extra probe molecule, which adds to the cost and complicates assay
design.
1.7 Performing a real-time RT-PCR experiment
In general, any experiment involving the PCR that begins with converting
an RNA template to cDNA will be more challenging than those that begin
with DNA templates. For that reason, the following discussion is centered
on RT-PCR. However, the basic principles and discussion concerning PCR
below would still apply to those starting with DNA.
Undoubtedly, the most important part of any RT-PCR experiment is the
isolation and purification of the RNA template before the experiment is
initiated. There are many methods for the isolation of nucleic acids. Most
are variants on a few basic isolation themes tailored to meet the special
26 Real-time PCR
h
h
Figure 1.10
Graphical representation showing the mechanism of action for an hybridization
probe pair. Two oligo probes bearing a single dye each, one with a fluorescein
dye at the 3’ end and the other with a rhodamine dye at the 5’ end. When the
two oligos anneal to a complementary template, the fluorescein dye is excited
by the light source in the instrument and transfers its energy to the rhodamine
dye via FRET. FRET can only occur when the two dyes are in close proximity.
The instrument is set to detect the rhodamime signal.
needs of the particular organism and/or target nucleic acid of interest
(Sambrook and Russell, 2001; Ausubel, 2001). There are a large number of
kits on the market for RNA or DNA isolation from different organisms,
tissue or cellular sources. One important factor is to minimize the amount
of DNA that is carried over with the RNA during isolation. This is important
because not all real-time assays cross exon junctions. Even if the assay does
cross an exon junction, pseudogenes may be amplified by the assay anyway
as they are spliced but imperfect copies of the original transcript reinserted
into the genome. For many transcripts, there are one or more pseudogene
copies in the mammalian genome. Of course for many organisms, e.g.,
those of viral and microbial origin, no exons exist. One sure way around
this problem in all cases is to DNase I treat each total RNA preparation.
Again, there are kits available for this process but it is not that hard to
perform this task yourself, as described in Protocol 1.1. Be aware that DNase
I treatment on a column as part of the RNA isolation procedure will not be
sufficient if your real-time assay has an amplicon shorter than 100 bases.
For the larger amplicons, found in SYBR® Green I or other primer-based
assays that are 200–250 bases in length, treatment with DNase I on the
column will suffice.
RNA from tissue culture cells can be isolated using most available
methods. Isolating RNA from tissues, however, can be more problematic.
Again potential complications are dependent upon the tissue involved. We
An introduction to real-time PCR 27
have found that homogenization of the tissue using a Polytron or bead-
beater device in a phenol-based guanidinium solution (Chomczynski, 1993)
works best for rapid degradation of the cellular structure and inhibition of
endogenous RNases. Regardless of the source, it is critical to minimize not
only DNA but also protein carryover during RNA isolation. The proteins
that most commonly carry over in any nucleic acid isolation procedure are
nucleic acid binding proteins. These DNA or RNA binding proteins can be
disruptive to the RT reaction and in particular, the following PCR. We have
found that binding the RNA to a column matrix and washing away protein
and other PCR contaminants results in the cleanest RNA for real-time PCR.
Column-based kits are available from many manufacturers. However, we
have developed a method that couples the superior disruption of a phenol-
based guanidinium solution with a column-based final purification of the
RNA (Protocol 1.2).
There are examples where this standard isolation method will not suffice.
Many plants and some microbes contain carbohydrates that will co-purify
with nucleic acids. In these instances, methods based on CTAB
(Cetyltrimethylammonium Bromide) can be used to isolate RNA or DNA
(Liao et al., 2004). Another method for further purifying RNA is precipita-
tion using LiCl (Lithium Chloride) instead of salt plus alcohol (Liao et al.,
2004). Isolation of RNA from small sample sizes, such as those from laser
capture microscopy, can require special handling (Gjerdrum et al., 2004).
Again, there are several kits on the market for this purpose.
There is nothing about the reactants used in setting up an RT reaction
and following PCR that is substantially different for analysis by real-time
PCR from those reactions designed for analysis using a gel. The only
differences are the concentrations of some of the reactants and the
inclusion of a fluorescent moiety for detection in a real-time reaction.
There are two critical elements to setting up any real-time PCR
experiment, the uniformity of the components in the reaction and the
accuracy and care with which each component, particularly the sample, is
added to the reaction.
It is important that all the components required for the reaction be
uniform from well to well if the results from multiple wells are to be
compared. To accomplish this goal, the concept of a master mix is critical.
Master mixes are, as the name implies, a combination of all the reactants
required for the RT reaction or the PCR minus the variable in the experi-
ment, usually the RNA, cDNA or DNA sample. Thus, all the reactants,
primers and probe (if used) are combined, mixed well and dispensed in an
equal volume into all the wells of a plate ensuring that each reaction is start-
ing with the same concentration of the basic reactants.
There are many commercially available kits on the market for both the RT
step and the subsequent PCR as either one-step or two-step reactions. As the
names imply, a one-step kit has reactants that will perform the RT reaction
and then the PCR within the same tube with no further manipulation
necessary by the investigator. In a two-step reaction, the reverse transcrip-
tase reaction is run in one tube and then all or some of the resulting cDNA
is used in the polymerase chain reaction, which is performed in a second
plate, tube or capillary. The advantage of a one-step method is a savings in
set-up time. However, there is always a compromise between the two
28 Real-time PCR
reactions as neither can be truly optimized. Further, all the template in a
one-step reaction will be used for that one reaction. Depending on how the
kit is formulated, a no-reverse transcriptase control may not possible. This
important control detects DNA contamination and ensures that low-level
transcript measurements are legitimate. A two-step kit takes more hands-on
time, as the cDNA is set up as a separate reaction and then introduced into
the PCR. In a two-step protocol, a no-reverse transcriptase control is easily
performed on each sample. Both the RT and the PCR can be optimized
individually and only a portion of the cDNA made need be used in any one
PCR. There are times when the use of one or the other assay system makes
sense and it is up to the investigator to make that decision. In general, if the
same results can be obtained with a one-step method compared to the same
template in a two-step procedure, the time saved and convenience using the
one-step kit makes a lot of sense. If this is not the case or the template is
limiting, a two-step method should be used.
In principle, kits for real-time PCR are a major convenience for the inves-
tigator. They are also a source of a readily available and consistent master
mix. However, they also add substantially to the cost of performing real-
time PCR. Our lab has been making master mixes by hand since 1996, when
there were no kits available. We continue to do so today. Formulas for
master mixes for a two-step RT and a probe-based PCR or SYBR® Green I PCR
are in Protocols 1.3, 1.4, and 1.5.
For purposes of the following discussion, a two-step method will be used
as an example. After distributing the RT master mix into the number of
wells required for the experiment, the samples are pipetted into wells
following an appropriate pattern for the experiment. This pipetting step is
THE most critical part of the experiment. A slight difference in RT master
mix volume from well to well will have a negligible effect on the quantita-
tive outcome of the experiment. In contrast, a very small difference in
sample volume among replicates for the same sample will have measurable
effects seen in the final data set. For this reason, recently calibrated
adjustable pipettors and a steady hand are the key. If the cDNA for each
sample is pipetted into replicate wells for the PCR, this step is the second
most critical pipetting step as errors here will be multiplied by the any errors
made in the initial template pipetting step. For this reason, in the examples
shown the PCR master mix is added directly to the entire cDNA reaction to
speed up assay setup and to avoid further errors in pipetting.
A good way for new investigators to gauge their pipetting skills is to make
a 7-log dilution series of a DNA template and then pipette the dilutions, in
triplicate, into a plate bearing PCR master mix in multiple wells. There is
nothing more humbling than seeing the results of this experiment for the
first time. Often, the replicates are not uniform and the points of the subse-
quent standard curve rarely fall onto a single straight line. There are two
places for pipetting error in this experiment, making the dilution series
itself and placing the diluted samples into the individual wells. A mistake in
either or both will be seen in the final data. With practice, the curves will
become uniform and straight.
Once the PCR plate, tube or capillary sets have been filled with all the
reactants, it is ready to be run on a real-time instrument. The set up of the
sample positions will be dependent upon the real-time instrument and
An introduction to real-time PCR 29
software. Although they all look different, the methodology of defining the
positions and quantities for the standards, unknown samples and controls
is pretty much the same for all instruments. One thing that is instrument-
specific is the thermocycling conditions. Instruments that use air to heat
the reactions tend to cycle much faster than instruments that use metal
blocks. There are new fast-blocks for some instruments in an attempt to
match the faster air heated systems. The important thing is to use the
cycling conditions that match your instrument, the reagents and the assay
components, mostly the primers. The first temperature is the melting step.
A one-minute melt at 94–95˚C is sufficient for assays with short amplicons
(<300 bases) using standard Taq. If a hot-start Taq is used, up to 15 minutes
will be required for enzyme activation depending on the activation system
used for the enzyme. For genomic DNA, at least 3 minutes is a safe time to
obtain a good melt for the PCR. Next comes the annealing temperature,
which will depend primarily upon the Tm of the PCR primers, their
concentration and the MgCl2 concentration in the master mix. A good
starting temperature range is 55–60˚C. If primer-dimers or inappropriate
PCR products are a problem, raise the annealing temperature in 2˚C
increments until the problem subsides or the reaction stops working. It may
be necessary to design a better primer pair if this does not solve the
problem. All probe-based assays can be run using 2-step cycles. That is from
94–95˚C to 60˚C and back to 94–95˚C. Good cycling times for these
reactions are 12–15 seconds at the high temperature followed by 30 seconds
at the lower temperature, usually for 40 cycles. For dye- or primer-based
assays, such as SYBR® Green 1, a 3-step cycle is generally used. Here, the
cycle stays at the annealing temperature for only 2 seconds and then goes
up to 72˚C (the optimal temperature for Taq DNA polymerase) for 30
seconds for each cycle (94–95˚C, 12–15 seconds; 55–60˚C, 2 seconds and
72˚C, 30 seconds). Collecting data at the higher temperature helps to melt
out primer-dimers.
This practical introduction to running a real-time PCR experiment
covered the basics of setting up a reaction. There is, of course, much more
to know about running and analyzing the data from a real-time experiment.
Those topics will be covered in succeeding chapters of this book.
1.8 What lies ahead
In this introduction, an attempt has been made to discuss some of the key
aspects that underlie the theory and practice of real-time PCR. It is far from
complete in covering all aspects necessary for the completion of a success-
ful real-time PCR experiment. In the chapters immediately following this
one, important topics critical for performing a real-time PCR experiment are
discussed in detail such as primer and probe design (Chapter 5), a discussion
of SYBR® Green I assay design and utilization (Chapters 7 and 8), post-run
data analysis (Chapter 2), different strategies for quantifying data (Chapter
3) and data normalization (Chapter 4). With this knowledge base, the new
investigator should be well armed to initiate their own studies using this
most robust and sensitive technique. Chapters 10–17 discuss, in a more
focused fashion, how real-time PCR is being utilized as an important tool in
different ways and areas of biological research.
30 Real-time PCR
References
Alwine JC, Kemp DJ, Stark GR (1977) Method for detection of specific RNAs in
agarose gels by transfer to diazobenzyloxymethyl-paper and hybridization with
DNA probes. Proc Natl Acad Sci USA 74: 5350–4.
Ausubel FM (2001) Current protocols in molecular biology. Wiley InterScience, New
York.
Bustin SA (2004) A–Z of quantitative PCR. International University Line, La Jolla,
CA.
Calogero A, Hospers GA, Timmer-Bosscha H, Koops HS, Mulder NH (2000) Effect of
specific or random c-DNA priming on sensitivity of tyrosinase nested RT-PCR:
potential clinical relevance. Anticancer Res 20: 3545–3548.
Chomczynski P (1993) A reagent for the single-step simultaneous isolation of RNA,
DNA and proteins from cell and tissue samples. Biotechniques 15: 532–534,
536–537.
Didenko VV (2001) DNA probes using fluorescence resonance energy transfer (FRET):
designs and applications. Biotechniques 31: 1106–1116, 1118, 1120–1121.
Gerard GF, Fox DK, Nathan M, D’Alessio JM (1997) Reverse transcriptase. The use of
cloned Moloney murine leukemia virus reverse transcriptase to synthesize DNA
from RNA. Mol Biotechnol 8: 61–77.
Gjerdrum LM, Sorensen BS, Kjeldsen E, Sorensen FB, Nexo E, Hamilton-Dutoit S
(2004) Real-time quantitative PCR of microdissected paraffin-embedded breast
carcinoma: an alternative method for HER-2/neu analysis. J Mol Diagn 6: 42–51.
Goldenberg O, Landt O, Schumann RR, Gobel UB, Hamann L (2005) Use of locked
nucleic acid oligonucleotides as hybridization/FRET probes for quantification of
16S rDNA by real-time PCR. Biotechniques 38: 29–30, 32.
Heid CA, Stevens J, Livak KJ, Williams PM (1996) Real time quantitative PCR. Genome
Res 6: 986–994.
Lakowicz JR (1983) Principles of fluorescence spectroscopy. Plenum Press, New York.
Liao Z, Chen M, Guo L, Gong Y, Tang F, Sun X, Tang K (2004) Rapid isolation of
high-quality total RNA from taxus and ginkgo. Prep Biochem Biotechnol 34:
209–214.
Mullis KB (1990) Target amplification for DNA analysis by the polymerase chain
reaction. Ann Biol Clin (Paris) 48: 579–582.
Peters IR, Helps CR, Hall EJ, Day MJ (2004) Real-time RT-PCR: considerations for
efficient and sensitive assay design. J Immunol Methods 286: 203–217.
Pierce KE, Sanchez JA, Rice JE, Wangh LJ (2005) Linear-After-The-Exponential
(LATE)-PCR: Primer design criteria for high yields of specific single-stranded
DNA and improved real-time detection. Proc Natl Acad Sci USA 102:
8609–8614.
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
Sanchez JA, Pierce KE, Rice JE, Wangh LJ (2004) Linear-after-the-exponential (LATE)-
PCR: an advanced method of asymmetric PCR and its uses in quantitative real-
time analysis. Proc Natl Acad Sci USA 101: 1933–1938.
Selvin PR (1995) Fluorescence resonance energy transfer. Methods Enzymol 246:
300–334.
Sherrill CB, Marshall DJ, Moser MJ, Larsen CA, Daude-Snow L, Prudent JR (2004)
Nucleic acid analysis using an expanded genetic alphabet to quench fluores-
cence. J Am Chem Soc 126: 4550–4556.
Southern EM (1975) Detection of specific sequences among DNA fragments
separated by gel electrophoresis. J Mol Biol 98: 503–517.
Vu HL, Troubetzkoy S, Nguyen HH, Russell MW, Mestecky J (2000) A method for
quantification of absolute amounts of nucleic acids by (RT)-PCR and a new
mathematical model for data analysis. Nucleic Acids Res 28: E18.
An introduction to real-time PCR 31
Winer J, Jung CK, Shackel I, Williams PM (1999) Development and validation of
real-time quantitative reverse transcriptase-polymerase chain reaction for
monitoring gene expression in cardiac myocytes in vitro. Anal Biochem 270:
41–49.
32 Real-time PCR
Protocol 1.1: Treatment
of total RNA with
RNase-free DNase I
1) Determine the RNA concentration of your samples
2) Dilute the total RNA to 100–500 ng/μl in DEPC-H2O
3) Prepare the following dilution of RNase-free DNase I
1/10 Dilution of RNase-free DNase I
Stock Volume
H2O 8 μl
10X PCR Bfr* 1 μl
RNase-free DNase I (10 U/μl) 1 μl
10 μl
4) Using the following table as a guide, make enough DNase I master mix to
add to all your RNA samples + 1 extra sample for overage
5) Add the appropriate volume of DNase I master mix to each RNA sample
tube
Treatment of total RNA
Stock Volume
Total RNA 120 μl
50 mM MgCl2 (1 mM final) 2.5 μl
1/10 DNase I (1 U/μl) 2.5 μl
125 μl
6) Incubate at 37°C for 30 min
7) Immediately transfer to 75°C for 10 min (exactly) to kill the DNase I; put
sample tubes on ice immediately after heating
8) Store the treated RNA at –80°C (good for at least 3 years)
*Any commercial nuclease-free 10X PCR buffer
Standard DNase I procedure from the Quantitative Genomics Core
Laboratory; UTHSC-Houston, Houston, TX 77030, USA
An introduction to real-time PCR 33
Protocol 1.2: Hybrid
protocol for the isolation
of total RNA
Follow the phenol/chloroform method (Tri-Reagent, Trizol, RNAsol, etc) with
the following modifications:
Step 1: Homogenize tissue samples
1) Homogenize tissue samples in a phenol-based reagent in the amounts
indicated:
The amount of reagent required may be greater for certain tissues; e.g.,
brain. If you don’t get a clear aqueous phase, add another ml of homoge-
nization reagent, vortex and spin. Repeat if necessary.
Tissue (mg) Phenol Reagent (ml)
100 1 ml
500 5 ml
1000 10 ml
2) Add tissue to the phenol reagent. Use a power homogenizer to homogenize
tissue for 1 min or until there are no tissue chunks (settings should be deter-
mined and optimized for the specific instrument). If tissue culture cells are
used, the phenol-based reagent can be added directly to the plates after the
media is removed. Cells removed by scraping.
3) Separate insoluble material from the homogenate by centrifugation at
12,000 × g for 10 min at 2–4˚C. The supernatant contains the RNA while
the pellet contains extracellular membranes. If working with adipose tissue,
remove the supernatant from under fat that collects as a top layer.
4) Transfer the cleared supernatant to a fresh tube being careful not to carry-
over any of the interface. Add 0.2 ml of chloroform for every 1.0 ml of
phenol reagent.
Step 2: Separate phases
1) Securely cap the tube from 4 above. Shake the tube vigorously for 2 min
(end to end).
2) Incubate at room temperature for 2 min.
3) Centrifuge at 12,000 × g for 15 min, 2–4°C.
The resulting sample should show 3 phases:
1–Lower red (Tri-Reagent) phenol-chloroform phase
2–White interphase
3–Upper colorless aqueous phase
34 Real-time PCR
The RNA remains exclusively in the upper aqueous phase. If the aqueous
phase appears cloudy, you may perform the chloroform extraction step up
to 3 times.
Step 3: Purify RNA on a Qiagen spin column
1) Transfer the clear aqueous phase into a new RNase-free tube. Add 0.5 ml
isopropyl alcohol per 600 μl of isolated aqueous phase. The correct final
alcohol concentration is critical for maximal binding to the column matrix.
2) Place solution on a Qiagen RNeasy mini or midi column (750 μl at a time).
Spin 30 sec at 13,000 RPM reloading with remaining solution until all has
passed through the column.
3) Continue with the washing and elution of the RNA as outlined in the
Qiagen instructions.
4) Elute the final RNA in DEPC-H2O.
Note: other column types can be used but the alcohol concentration has to be
compatible, otherwise the RNA may not stick to the column matrix.
Step 4: Check the quality of the RNA
1) Read a sample of your RNA solution (1/50 dilution) on a spectrophoto-
meter. The ratio of absorbance at 260 nm to that at 280 nm (A260/280
ratio) should have values of 1.8–2.0 (2.2 is max for RNA).
2) Calculate the concentration of total RNA in the sample from the 260 nm
reading. An optical density (OD) of 1.0 corresponds to approximately 40
μg/ml of single-stranded RNA.
Standard Protocol for the isolation of RNA from the Quantitative Genomics
Core Laboratory; UTHSC-Houston, Houston, TX 77030, USA
An introduction to real-time PCR 35
Protocol 1.3: Two-step
master mix
RT-1 A – 10 μl Rxn B – 5 μl Rxn
Stock Component Final Volume (μl) Volume (μl)
***** DEPC-H2O ***** 2.60 1.30
10X Rev Transcriptase Bfr 1X 1.00 0.50
2.5 mM dNTP mix 500 μM 2.00 1.00
20 μM Assay-specific reverse 400 nM 0.20 0.10
primer
50 U/μl MMLV reverse 10 U/10 μl 0.20 0.10
transcriptase 6.00 3.00
RT-2 (−RT or NAC control) 10 μl Rxn 5 μl Rxn
Stock Component Final conc. Volume (μl) Volume (μl)
***** DEPC-H2O ***** 2.80 1.40
10X Rev transcriptase Bfr 1X 1.00 0.50
2.5 mM dNTP mix* 500 μM 2.00 1.00
20 μM Assay-specific reverse 400 nM 0.20 0.10
primer 6.00 3.00
1) Add 6.0 μl (A) or 3 μl (B) RT-1 to 3-wells/sample
2) Add 6.0 μl (A) or 3 μl (B) RT-2 to 1-well/sample
3) Add 4.0 μl (A) or 2 μl (B) total RNA/well (2.5–50 ng/μl)
4) Incubate using RT program = 50°C – 30 min; 72°C – 5 min; 20°C – hold
*–2.5 mM dNTP mix – equal volumes of the 4 dNTPs at 10 mM
Standard RT master mix from the Quantitative Genomics Core Laboratory;
UTHSC-Houston, Houston, TX 77030, USA
36 Real-time PCR
Protocol 1.4: Two-step
PCR master mix for
probe-based assays
PCR-1 50 μl Rxn 25 μl Rxn
Stock Component Final conc. Volume (μl) Volume (μl)
***** PCR-H2O ***** 23.20 11.60
10X PCR Bfr 1X 5.00 2.50
15 μM SuperROX™ (Biosearch) 90 nM 0.30 0.15
50 mM MgCl2 5 mM 5.00 2.50
2.5 mM dNTP mix* 200 μM 4.00 2.00
20 μM Forward primer (+) 400 nM 1.00 0.50
20 μM Reverse primer (–) 400 nM 1.00 0.50
20 μM Probe 100 nM 0.25 0.13
5 U/μl Taq (regular or hot-start) 1.25 U/50 μl 0.25 0.13
40.00 20.00
1) Add 40 μl (A) or 20 μl (B) PCR-1 to each of 4 wells cDNA/assay
2) Use the following cycle program:
95°C – 1–15 min; 40 cycles of 95°C – 12–15 sec, 60°C – 30–60 sec
*–2.5 mM dNTP mix – equal volumes of the 4 dNTPs at 10 mM
Standard RT master mix from the Quantitative Genomics Core Laboratory;
UTHSC-Houston, Houston, TX 77030, USA
An introduction to real-time PCR 37
Protocol 1.5: Two-step
PCR master mix – primer
or SYBR® Green I based
assay
PCR-1 50 μl Rxn 25 μl Rxn
Stock Component Final conc. Volume (μl) Volume (μl)
***** PCR-H2O ***** 12.70 6.35
10X PCR Bfr 1X 5.00 2.50
15 μM SuperROX™ (Biosearch) 90 nM 0.30 0.15
40% Glycerol 8% 10.00 5.00
10% Tween 20 0.10% 0.50 0.25
50 mM MgCl2 5 mM 5.00 2.50
2.5 mM dNTP mix* 200 μM 4.00 2.00
20 μM Forward primer (+) 400 nM 1.00 0.50
20 μM Reverse primer (–) 400 nM 1.00 0.50
20 μM Probe 100 nM 0.25 0.13
5 U/μl Taq (regular or hot-start) 1.25 U/50 μl 0.25 0.13
40.00 20.00
1. Add 40 μl (A) or 20 μl (B) PCR-1 to each of 4 wells cDNA/assay
2. Use the following cycle program:
95°C – 1–15 min; 40 cycles of 95°C – 12–15 sec, 60°C – 2 sec, 72°C – 30–60
sec
*–2.5 mM dNTP mix – equal volumes of th 4 dNTPs at 10 mM
Standard RT master mix from the Quantitative Genomics Core Laboratory;
UTHSC-Houston, Houston, TX 77030, USA
Data analysis and
reporting
Pamela Scott Adams
2
2.1 Introduction
Proper data analysis is crucial to obtaining valid and relevant results from
any experimental system, but is especially critical when assessing variations
in mRNA expression of genes, the so-called transcriptome. Unlike DNA
which is present in each cell throughout the life of the organism, RNA is
transiently expressed and levels vary according to cell type, developmental
stage, physiology and pathology. Therefore, quantification of RNA is context
dependent and inherently variable. Extra vigilance must be exercised to
ensure the data are technically accurate before they can be examined for
biological relevance. It should always be remembered that mRNA expression
does not necessarily correlate with protein expression and protein expres-
sion may not correlate with function. Regardless of the instrument used to
perform quantitative real-time PCR, certain basic conditions should be met.
The assay should be robust and fulfill all criteria for a good assay. A standard
curve using a defined template should result in a slope, coefficient of deter-
mination (r2) and y-intercept that demonstrate good efficiency, accuracy and
sensitivity. The baseline and threshold should be properly set. The amplifi-
cation curves should demonstrate exponential amplification and be within
the detection limits of the instrument. Proper controls should be included to
monitor contamination and sensitivity of the assay. Genomic contamina-
tion should be assessed, if applicable. Data should be reported in a manner
that allows the variability of results to be seen. Proper statistical analyses
should be applied to the data.
What will be covered in this chapter? There are many applications utilizing
real-time PCR, but the most common is the 5’ exonuclease or TaqMan® assay
used to quantify gene expression using a set of primers and a dual-labeled
fluorescent probe. This chapter will focus on the preliminary analysis of data
for this popular utilization of real-time PCR. All subsequent analyses will be
based on the accuracy of the post-run preliminary analysis. Therefore, the
samples in a real-time PCR run must be verified as valid before any further
interpretation of the results is possible. Assay design, SYBR® Green I assays,
normalization, relative quantification, along with more specialized uses and
analyses will be covered in other chapters. Starting with the questions: are the
primer/probes giving a good assay and what constitutes a good assay,
standard curves, how to interpret them and use them to improve your assays,
will be discussed. When you take the first look at the results of a real-time PCR
run, what to look for and how to look will be described: how to set the
40 Real-time PCR
baseline, the threshold, assess the controls and how to interpret the wide
variety of amplification curves (or no curves) which might be encountered.
Are the amplifications curves real? Are the no template controls (NTCs)
negative? Examples are shown for specific instruments, but the principles
should be applicable to all instruments. Illustrations of common problems
that can arise will be described, so that they will be recognized if they occur.
Data comparing the results obtained from nine different instruments using
default instrument values or operator-adjusted values will be shown. An
example of the basic principles of data reporting and statistics will be shown.
This chapter should be especially helpful to researchers, such as core facility
personnel, who have the opportunity to deal with the real-time PCR prelimi-
nary data analysis of numerous users.
A quick review of terminology used in preliminary data analysis is in
order to promote understanding of why the analysis settings are so impor-
tant. The Ct is defined as the cycle when sample fluorescence exceeds a
chosen threshold above background fluorescence. This is also known as the
Cp or crossing point. A positive Ct results from genuine amplification, but
some Ct values are not due to genuine amplification and some genuine
amplification does not result in a Ct value. Therefore, regardless of the
terminology, the key word is ‘chosen’. The Ct is determined by both the
chosen baseline setting and the chosen threshold setting. These settings
may be selected by the user or the user may accept the default values of the
software. Values can be fixed or they can be adaptive. In most cases the
reporter signal is normalized to a reference dye by dividing the raw fluores-
cence of the reporter by the fluorescence of the passive reference, to
compensate for minor well-to-well variation. This value is referred to as the
Rn, the normalized reporter signal. When the background value has been
subtracted from the Rn, then this value is referred to as delta (Δ) Rn, the
normalized fluorescence value corrected for the background.
2.2 Standard curves
Before discussing the actual preliminary analysis procedure, it is wise to
have a good understanding of what constitutes the best possible assay.
Information on primer and probe design will help with this task if you are
designing your own assay. Often it is more convenient to use a published
assay, however, keep in mind that just because a primer/probe set is
published, it is no guarantee that an optimal assay will result. Also, typo-
graphical errors in published DNA sequences of any type abound, so BLAST
(basic local assignment tool) all sequences before using them to insure they
are correct. If the information is not included in the publication, it is a good
idea to check the sequence and melting temperatures (Tm) of the primers
and the probe just to assure that the assay meets basic design requirements,
before going to the expense of purchasing the primer/probe set. Checking
the relationship of the primers/probe to intron/exon boundaries will make
you aware of the importance of having controls that determine genomic
DNA contamination in RNA preparations. Similarly, checking amplicon
size will prevent any unpleasant surprises. Perhaps these measures are
‘overkill’ but they can save time and money in the long run. The assay
should always be validated using the conditions in your laboratory.
Data analysis and reporting 41
How to determine if an assay is optimal? The standard curve is a very useful
tool for determining the qualities of an assay. Using a defined template, such
as a plasmid containing a relevant portion of the gene of interest, PCR
product, synthetic oligonucleotide or transcribed RNA to perform a standard
curve, will allow determination of the PCR efficiency of the assay along with
the sensitivity and dynamic range independently of any variables associated
with the sample preparation and/or reverse transcription.
How is a standard curve generated? Begin with determining the OD260 of
the template sample.
The amount of the template should be expressed in molecules. Convert
the mass to molecules using the formula:
Mass (in grams) × Avogadro’s Number
ᎏᎏᎏᎏᎏᎏ = molecules of DNA
Average mol. wt. of a base × template length
For example, if a synthetic 75-mer oligonucleotide (single-stranded DNA)
is used as the template, 0.8 pg would be equal to 2 × 107 molecules:
0.8 × 10–12 gm × 6.023 × 1023 molecules/mole
ᎏᎏᎏᎏᎏᎏ
330 gm/mole/base × 75 bases
= 2.0 × 107 molecules (copies) of DNA
For double-stranded templates, use 660 gm/mole/base. To generate a
standard curve, prepare seven 10-fold dilutions, starting with 1 × 107
template copies and ending with 10 copies. Be sure to use a carrier such as
tRNA to minimize loss of template at low concentrations. Use a previously
determined optimized primer/probe concentration that gives the highest
ΔRn and the lowest Ct.
Most platform software will plot a standard curve using designated wells
or Microsoft Excel® can be used to draw xy plots with the log template
amount as the x value and the cycle threshold (Ct) as the y value. A line
representing the best fit is calculated for a standard curve using the least
squares method of linear regression:
y = m x + b where y = Ct, m = slope, x = log10 template amount,
and b = y-intercept.
The coefficient of determination, r2 should also be noted.
What does each parameter tell us? Assay efficiency is based on the slope
of the line, calculated by the formula:
Efficiency = [10(–1/slope)] – 1
Efficiency is primarily an indication of how well the PCR reaction has
proceeded.
The integrity of the data fit to the theoretical line is described by the r2.
This is a measure of the accuracy of the dilutions and precision of pipetting.
The y-intercept is an indication of the sensitivity of the assay and how
accurately the template has been quantified.
42 Real-time PCR
>37 䊉 Perfect assay
䉬 Poor efficiency
䉬 䉬 Underestimated quantity,
33–37
䉬 degraded template
䊉
䉬
䊉
䉬
䊉
䉬
䊉
䊉 䉬
Ct
䊉
䊉
Log10 template molecules
>37 Slope = –3.3
䉬 y-int high
䉬
33–37
䉬
䊉
䉬
䊉
䉬 Slope = –4.0
䊉 y-int high
䉬
䊉
Slope = –3.3 䊉 䉬
Ct
y-int good
䊉
䊉
Log10 template molecules
Figure 2.1
Standard curve cartoons. Exaggerated depictions of a ‘perfect’ standard curve
(closed circles) and the effect that low efficiency (open circles) or inaccurate
template quantification or degraded template has on the y-intercept (closed
diamonds).
What constitutes a good assay? Figure 2.1 is an exaggerated depiction of
the standard curve of a ‘perfect’ assay and what influence an alteration of
the parameters will have on the outcome. By expressing the template
amount in molecules, the formula below can be used to determine how
many cycles are necessary to produce a specified number of molecules.
n = Log(Nn) – log(No)/log(1+E) Where Nn = number of copies of the
template after n cycles, N0 = number of copies of the template at cycle 0,
E = efficiency and n = number of cycles.
Taking into account that the signal detection limit of free FAM is 1010 –
1011 molecules on most platforms, it is possible to determine that at 100%
PCR efficiency, a single copy of template should be detected between
33.3–36.5 cycles. Therefore, a perfect assay would have a slope of –3.32
Data analysis and reporting 43
Figure 2.2
Standard curve of degraded template. Real example of a standard curve using a
template that has degraded during storage.
(100% efficiency), a y-intercept between 33 and 37 cycles and an r2 of 1.00.
Figure 2.1 demonstrates that as the slope of the line increases (becomes
more negative), the efficiency decreases, the y-intercept increases and the
sensitivity of the assay suffers because more starting copies are needed
before the detection limit is reached. Or, more cycles are required to detect
the same number of template molecules. This may be a distinct disadvan-
tage if dealing with genes that have low expression. Make a spreadsheet
using the formulas above and see for yourself what effect alteration of the
efficiency has on detectable copy number or the cycle at which the sample
will be detected.
An example where efficiency may not be optimal, even though the
primers and probes have been properly designed, is the case of a non-
linearized plasmid being used as a template for the standard curve. Because
of super-coiling, 100% of the copies of the plasmid are not available for
initial PCR resulting in low efficiency at the start, but once the new ampli-
cons outnumber the plasmid, efficiency is 100%. The net result is an under-
estimation of copy number. This is why plasmids should always be
linearized before using them as templates for standard curves. However,
efficiency is not necessarily the only measure of assay quality. An assay can
have an apparently acceptable efficiency of 95–100% but if the y-intercept
is substantially higher than 37 or lower than 33, it indicates that the
amount of template has not been correctly determined. In the case of a high
y-intercept, deterioration of the template is likely (Figure 2.2). Degradation
of template is a common result of too many freeze–thaw cycles of the
standard or storing the template at too low a concentration without a
carrier.
44 Real-time PCR
Once the assay has been validated using a standard curve, then it can be
used with cDNA or a universal RNA standard in a similar manner to
optimize sample preparation and reverse transcription by monitoring assay
efficiency. Of course, in reality, not every assay will be perfect, but an
attempt should be made to develop the best assay possible or at least know
what the weaknesses of an assay are.
Preliminary analysis flowchart
Examine amplification curves
Check/adjust baseline
Check/adjust threshold
Check no template controls
Check positive controls
Check –RT controls
Check samples
Perform experiment specific analysis
Figure 2.3
Flow chart for preliminary analysis. Parameters to check during preliminary
analysis of data obtained from a real-time PCR run.
Data analysis and reporting 45
2.3 Preliminary assay analysis
The experiment has been carefully planned, set up and run. The run is
finished and now it is time to analyze the data. What to look at first? Do we
really know what the analysis settings do? Does it matter? The most
common place to start preliminary analysis of a real-time PCR run is using
the Amplification view that allows adjustment of the baseline and thresh-
old values. The default view for most software plots cycle number on the x
axis versus the logarithm of the ΔRn on the y axis. Figure 2.3 shows a
flowchart with suggested steps of parameters to check and in what order.
The steps in the flowchart are meant to be a guideline and it may be neces-
sary to adjust some parameters, such as the threshold, more than once.
Some instruments require that a baseline and threshold be accepted before
further manipulations of the software can be executed, but all instruments
allow the user to change the baseline and threshold and reanalyze at will.
All analysis scenarios presented in this chapter assume that the instrument
is working properly.
Figure 2.4
Effect of incorrect dye layer settings. A. Amplification view showing the
incorrect dye layer (TAMRA). B. Amplification view showing the incorrect dye
layer (SYBR®). C. Amplification view showing the correct dye layer (FAM).
D. Curves showing the relationship among spectra for the dyes FAM, SYBR®
(Green I) and TAMRA. Arrow at ‘a’ identifies Ct of the same amplification curve
under different analysis conditions.
46 Real-time PCR
2.3.1 Amplification curves
What if there are no curves or curves that look unusual? This situation must
be dealt with before any further analysis is possible. The first parameter that
should be checked is that the correct dye layer or reporter has been desig-
nated. This seems like a very simple proposition, but if there are no ampli-
fication curves or strange curves this is the most likely explanation. This
problem occurs most often on multi-user instruments and when templates
are routinely used. The result of choosing the wrong template with the
incorrect dye layer can be as drastic, as very few amplification curves above
the threshold as shown in Figure 2.4A (Ct of a = 33) when TAMRA is chosen
for the dye layer for a FAM probe or very subtle as the instance when a
SYBR® Green I template is chosen when using a FAM probe, as shown in
Figure 2.4B, (Ct of a = 17). If the spectral calibration curves are viewed (Figure
2.4D), it is easy to see that the TAMRA spectrum is quite different from FAM.
However, because the FAM and SYBR® Green I have overlapping spectra, the
amplification curves will appear quite respectable and the Ct values may be
indistinguishable (Ct of curve ‘a’ is 17 in Figure 2.4B and 2.4C). Only by
checking that the correct dye layer has been chosen will the discrepancy be
detected. One other way to detect/verify this problem is to select a well and
look at it in the Raw Spectra view with the best fit option turned on. The
curve of the raw spectra for the well and the fit curve should be superim-
posed on each other. If they are not this is an indication that the wrong
reporter is being monitored (or there is contamination with another dye on
the plate or in the sample block). What can be done to correct this problem
if it occurs? Go to the set-up view, select the proper dye layer, reassign the
wells and reanalyze to get the proper Ct values as shown in Figure 2.4C. One
way to minimize the chances of the wrong dye layer being used is to reboot
the data collection computer between individual runs, which resets
template/software parameters to their previously assigned values.
What if the Amplification view looks like the one shown in Figure 2.5A,
with very erratic amplification plots and an unusual threshold? This occurs
on the ABI 7700 (Applied Biosystems, Foster City, CA, USA) when it
encounters wells that have no fluorescence in them. This may be a result of
mistakenly designating wells as containing a sample when they are actually
not being used, or the over zealous newbie who wants to include a water
blank. The troublesome wells can be identified by selecting all wells on the
plate and observing them in the Raw Spectra view. They will be most appar-
ent if looked at after 40 cycles of amplification. The empty wells will have
flat fluorescent traces, as shown in Figure 2.5B. The lack of fluorescence from
probe and/or reference dye can be verified by examining the individual
wells in the Multicomponent view (Figure 2.5C) which allows viewing of the
raw fluorescence in an individual well. The problem is resolved by switch-
ing to the set-up view and designating the offending wells as ‘not in use’
and reanalyzing the data without the blank wells. Now the curves look
quite respectable, as shown in Figure 2.5D and an example Ct (b) is corrected
from 29 to 17.
One other anomaly that can generate very weird curves is having ROX
designated as the reference dye when in fact there is no ROX in the
reaction. The amplification curves will look similar to Figure 2.5A. Turning
Data analysis and reporting 47
Figure 2.5
Effect of including wells with no fluorescence. A. Appearance of the
amplification view if wells have been selected that contain no fluorescence.
(a) artifact, (b) real amplification. B. Raw data view of all samples.
C. Multicomponent view of (a) verifying the absence of fluorescence.
D. Appearance of the amplification view after removing the wells with no
fluorescence and reanalyzing. Sample b has a Ct of 17 compared to a Ct of
29 in panel A.
off ROX as a reference and reanalyzing, restores the curves to their proper
configuration.
2.3.2 Baseline
If there are some reasonable amplification curves, the next parameter that
should be examined is the baseline setting. Each real-time PCR instrument
48 Real-time PCR
Figure 2.6
Effect of baseline settings. A. Amplification view showing an incorrect baseline
setting (3–15 cycles) and the resulting artifacts: (a) half rainbows and (b) a full
rainbow, plotted using a logarithmic scale for the y axis (ΔRn). B. The same
curves in the amplification view plotted using a linear scale for the y axis.
C. The same curves corrected to a baseline of 3–7 cycles in the amplification
view plotted using a linear scale for the y axis. D. The same curves corrected to
a baseline of 3–7 cycles in the amplification view plotted using a logarithmic
scale for the y axis.
has baseline-setting algorithms that determine the background noise of the
detector and reagents using the fluorescence generated in a designated
number of cycles at the beginning of the run. This may be a fixed number
of cycles for all samples or adaptive for each sample, depending on the type
of instrument that is being used. Baseline anomalies may be slight or severe.
Look at the left hand corner of the Amplification plot. Are there ‘half-
Data analysis and reporting 49
Figure 2.7
Effect of baseline settings on a standard curve. A. Standard curve of the data
shown in Figure 2.4 before adjusting the baseline. B. Standard curve of
the data shown in Figure 2.4 after adjusting the baseline.
rainbows’ or what looks like half an arc or hump between cycles 1 and 10?
These arcs frequently start above the threshold, as shown in Figure 2.6A.a.
In extreme cases, complete ‘rainbows’ in which the total curve is affected,
may be seen. The ‘rainbows’ may appear under the threshold and the Ct
may register as 40 (Figure 2.6A.b) or the curve may cross the threshold in
two places (not shown). Examination of the Raw Spectra view or the
Multicomponent view, which allows viewing of the raw fluorescence in an
individual well, will clarify if there is real amplification or not. At what cycle
does the lowest Ct appear? If the lowest Ct is less than the upper limit of the
baseline setting (the upper limit of the baseline setting is greater than the
50 Real-time PCR
lowest Ct), then the baseline should be adjusted. A general rule of thumb is
to set the upper limit of the baseline 2–3 cycles less than the lowest Ct. A
good way to determine exactly where to set the baseline on many
machines, is to examine the amplification curves with the y axis (ΔRn) set
to a linear scale rather than a logarithmic scale. If the baseline is set with the
upper limit of the baseline too high, then the curves exhibiting a very low
Ct, will appear below the baseline, as in Figure 2.6B. Adjust the baseline until
the linear part of the curves follow the baseline, as in Figure 2.6C. Correct
adjustment of the baseline should result in proper looking curves in the
logarithmic view with disappearance of the rainbows, as in Figure 2.6D. In
this example, the effect of adjusting the baseline results in seven usable
points in the standard curve (Figure 2.7A and 2.7B), instead of six and the
efficiency of the standard curve improves from 114% to 104%. It is also
possible to have the upper limit of the baseline set too low, so be sure to
check it in the linear view, even if the curves look acceptable in the logarith-
mic view. The most notable effect from adjusting the baseline will usually
be on samples with the lowest Ct and the highest amount of template.
However, limiting the number of cycles over which the baseline is calcu-
lated can interfere with the detection of less abundant targets, in some rare
cases. In cases of severe overloading of the template, it may be possible to
eliminate the offending samples from the analysis as in the case of a
standard curve where there are multiple doses from which values can be
calculated. However, this may affect the efficiency as demonstrated in the
example above. If the problematic wells are critical to the experiment, for
example the reference gene, then it may be necessary to repeat the experi-
ment using a lesser amount of template, remembering that a two-fold
dilution of template will only change the Ct by a factor of 1. Gene expres-
sion being too high is common to reference or standardization genes
because they are so abundant.
2.3.3 Threshold
Correct placement of the threshold is the next crucial step in data analysis.
As for the baseline, each instrument uses variations of a threshold-setting
algorithm to set this value. For instance, the Applied Biosystems 7700 SDS
(Sequence Detection Software) calculates the threshold value as 10 standard
deviations from the baseline. For this reason, the baseline must be set before
adjusting the threshold value. Keep in mind that an amplification curve is
composed of four components: background, exponential phase, linear
phase and the plateau (Chapter 1). To adjust the threshold properly, set the
threshold value within the exponential phase of all amplification plots
when viewed using the logarithmic scale for the y axis. If it is not possible
to place the threshold in the proper place for all curves due to variations in
the abundance of the various genes and/or the amount of fluorescence
generated by a particular probe, then it is permissible to analyze sets of
curves with different thresholds. Multiple thresholds are the exception
rather than the rule, but can be very helpful in situations where there is a
low abundance mRNA that generates very low ΔRn values (Bustin and
Nolan, 2004a). How do you know exactly where to set the threshold in the
exponential phase? This is a matter of debate, with some believing that the
Data analysis and reporting 51
0.1
Fluorescence (dRn)
0.01
0.001
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles
Threshold Calculated RNA copy # Slope y-Int r2
0.004 2.26E7 2.92E4 3.01E2 3.23 33.86 0.999
0.012 2.51E7 2.46E4 2.72E2 3.25 35.45 0.999
0.020 2.46E7 2.44E4 2.52E2 3.26 36.32 0.999
0.028 2.33E7 2.57E4 2.41E2 3.26 36.98 1.000
0.036 2.30E7 2.58E4 2.40E2 3.27 37.56 1.000
0.044 2.23E7 2.57E4 2.32E2 3.27 38.02 1.000
0.052 2.27E7 2.53E4 2.25E2 3.27 38.54 1.000
0.060 2.30E7 2.51E4 2.17E2 3.26 38.86 0.999
Mean 2.33 2.57 2.48
SD 0.10 0.15 0.27
Figure 2.8
Comparison of parameters relative to adjustment of the threshold. A standard
curve was run using a synthetic oligonucleotide. Ten-fold dilutions of a known
amount of in vitro transcribed RNA were used as ‘unknowns’. Representative
values of the calculated copy number of RNA at each threshold setting in the
unshaded (exponential phase) area of the amplification plot figure are shown.
Slope, y-Intercept and r2 for the RNA curves are calculated values. Data were
provided by Brian P. Holloway and Karen McCaustland from the DNA Core
Facility at the Centers for Disease Control and Prevention, Atlanta, GA, USA.
lowest possible threshold is best. Some analysis software adjusts the thresh-
old so that a standard curve will have the highest r2. Still others believe that
the most accurate Ct is obtained by selecting the point of maximum curva-
ture on a 2nd derivative curve (second derivative maximum (SDM)). Figure
2.8 shows the effect of adjusting the threshold within the exponential
phase of the curves on the calculation of values from a standard curve. Little
effect on the calculated number of known template copies is seen in this
example where the threshold setting is varied, demonstrating that there is
not a single optimal threshold value. Setting the threshold as low as
possible results in lower Ct values, which may be beneficial under some
52 Real-time PCR
Table 2.1 Comparison of instrumentation efficiency using default versus manually adjusted
settings. Standard curves were set up and run by the same operator using nine different
instruments*
Default analysis settings Adjusted analysis settings Difference
Instrument Efficiency y-Intercept Efficiency y-Intercept Δ Efficiency Δ y-Intercept
ABI Prism® 7500 128% 33.3 99% 35.9 –29.0% –2.67
ABI Prism® 7700 106% 35.8 103% 35.9 –3.0% –0.10
BioRad iCycler® 100% 34.8 98% 35.9 –1.3% –1.12
Cepheid 94% 38.5 96% 36.9 –2.7% –1.62
SmartCycler I®
Corbett 101% 36.3 101% 37.4 –0.3% –1.04
Rotorgene™
Roche LC 1.2® 95% 36.8 94% 38.1 –0.8% –1.32
Roche LC 2® 99% 34.5 98% 35.9 –1.7% –1.41
Stratagene 102% 37.8 103% 35.9 –0.6% –1.83
Mx3000p®
Stratagene 101% 36.9 102% 35.9 –0.5% –0.97
Mx4000®
Mean 103% 36.1 99% 35.9 –3.5% –0.21
Range 94%–128% 33.3–38.5 94%–103% 35.90–38.11 0.3%–29% 0.21–2.67
*Data was provided by Brian P. Holloway and Karen McCaustland from the DNA Core Facility at the Centers
for Disease Control and Prevention, Atlanta, GA, USA.
circumstances. However, a two-fold difference in copy number should have
one Ct difference no matter where the threshold is set within the expo-
nential phase of amplification, providing the efficiency is close to 100%.
Curve fitting, baseline and threshold algorithms are not universal across
platforms, however the end result can be similar. A comparison of PCR
efficiency and y-intercept values on nine different platforms using the
instrument default settings versus manually optimizing baseline settings
and thresholds is shown in Table 2.1. In the majority of cases, the default
settings provide results quite similar to those that were manually adjusted.
Adjusting the baseline was especially beneficial for some instruments in this
example because a high dose of standard was used and the default baseline
was set too high. Because calculated concentrations will vary somewhat
across different platforms, a standard curve should be used when comparing
quantitative data between platforms. In the end, the data is relative.
Probably the most important factor is to be consistent with subsequent
runs. If large differences exist between test samples, then fine-tuning the
baseline and threshold may not be so important, but if detecting two-fold
or single Ct differences are desired, then proper adjustment becomes critical.
2.3.4 Proper controls
No template controls
Part of deciding where to set the threshold depends upon the negative
controls. No template controls (NTCs) should always be included on every
plate in every experiment! These controls assure that what is being
Data analysis and reporting 53
Figure 2.9
False amplification. A. Amplification view showing an acceptable amplification
curve (a) and unacceptable curves (b, c) plotted using a logarithmic scale for
the y axis (ΔRn). B. The same curves plotted using a linear scale for the y axis.
C. Multicomponent view of sample b. D. Multicomponent view representative
of one of the c sample wells.
measured is in the sample and not a contaminant. A good recommendation
(Bustin and Nolan, 2004a) is to disperse NTCs over the plate. For example,
prepare 2–3 NTCs in the first few wells on the plate and seal these wells
before adding template to any of the other wells. Then prepare 2–3 NTC
wells after all the templates have been added. This technique should help
determine how the contamination is being introduced if positive NTCs
become an issue. What if the NTC is reported as a Ct value less than 40?
Inspection of the shape of the amplification curves can be informative.
Sometimes a curve is seen that is gradually increasing, but not exponen-
tially, and crosses the threshold at some point, as shown in Figure 2.9A.b. In
other cases one might see curves that look like very low amplification
curves (Figure 2.9A.c). Observing the shape of the curves with ΔRn expressed
on a linear scale (Figure 2.9B) emphasizes that these curves are far from
optimal. One cause is a decreasing ROX signal as the FAM signal remains
the same, aptly called ROX drop. Another cause is a slight increase in FAM
signal while the ROX remains the same, known as FAM creep. Both can
occur to varying degrees and at the same time. Since most software divides
the FAM signal by the ROX signal to normalize each well, the software
interprets this change as amplification. Examination of the Multi-
component view allows viewing of all the fluorescent reagents in an
54 Real-time PCR
individual well so the relationship between the reporter signal and the refer-
ence dye can be observed as demonstrated in Figure 2.8C and 8D. Extreme
cases can often be caused by evaporation resulting from improper sealing of
that well. What is the solution to non-exponential or false positive NTC? In
many cases, upward adjustment of the threshold is sufficient to eliminate
the positive NTC. In some instances, the rogue well can be removed from
the analysis if it is technically faulty. Careful attention to technique should
minimize this type of problem.
What if the NTC show real exponential amplification? NTC contamina-
tion can be of several varieties. The contaminant can be a PCR product from
a previous real-time PCR experiment. Theoretically, if the tubes from a real-
time PCR run are never opened and disposed in an area far removed from the
set-up area, then this type of contamination should not occur. However, in
reality there might be occasions when the tubes are opened. For example,
when an assay is being validated and the amplicon is run on a gel to check
for a single product or purified to sequence the amplicon to check for speci-
ficity. At least one manufacturer of master mixes has addressed this problem
by using dUTP (2’ deoxyurindine 5’ triphosphate) instead of dTTP and
including the enzyme uracil-N-glycosylase (UNG). The UNG should digest
any carry-over real-time PCR products that have incorporated dUTP. This is
why there is a 2 minute step at 50°C step included in the thermocycling
protocol if there is UNG in the master mix. The 2 minute step at 50°C inacti-
vates the UNG so it does not affect subsequent PCR products being gener-
ated in the current run. A down side of using this enzyme is that if a little bit
of residual activity is left, the UNG will begin to digest the amplicons in the
current PCR reaction. This only becomes important if it is necessary to
sequence the amplicon or run it on a gel. In this case, remove the samples
from the machine immediately after the run and store them in the freezer
until time to run them on a gel. How to determine if contamination is from
carryover from previous real-time PCR runs? If a master mix containing
dUTP but no UNG is used, add UNG to the master mix and see if this elimi-
nates the positive NTC. Consider using UNG routinely. Of course, the ideal
situation is to prevent the carryover contamination from happening, but
this is not always practical, especially in multi-user situations. If dTTP is used
in the real-time PCR reactions, then it will not be possible to determine the
source of contamination by this method. What if dUTP and UNG are used in
the reactions and the NTCs are still less than 40? Examination of the Raw
Spectra and/or Multicomponent views shows the beginning of genuine
exponential amplification. Primary contamination (as opposed to carry over
contamination) is especially common when plasmids, PCR products and/or
synthetic templates are used for standard curves. The standard becomes a
contaminant unless stringent technique is exercised. Replacing all reagents,
cleaning preparation sites, and moving to another building are all methods
by which to escape from contamination. These measures are not always
totally successful and the positive NTC situation must be dealt with.
Likewise, if the samples are small and irreplaceable, there may be no choice
but to deal with a positive NTC. Here is where some judgment much be
carefully exercised. Here are some recommended suggestions (Bustin and
Nolan, 2004a) that should be considered. If the NTC is between 35 and 40
cycles and the sample Ct is 25 or greater than 10 cycles lower than the NTC,
Data analysis and reporting 55
then it is reasonable to think that the sample amplification is real. If the
sample Ct is 30 and the NTC is 35 this should give serious pause. If the NTC
is less than 30 cycles, then there is most likely a serious contamination
problem. Another example of when NTCs need to be carefully examined is
when the sample Ct values fall in the 35–39 cycle range. In this case, it is very
important to verify that the sample is truly above background. One way to
accomplish this is to add more template to the reaction. The NTCs should
remain the same and the sample Ct should decrease 1 Ct for every two-fold
increase in template. If the template is a limiting factor, as is frequently the
case when using a small number of cells or micro-dissected tissue, then it is
important to increase the number of cycles in the run to verify that there is
greater than 10 Ct difference between the sample and the NTC.
No reverse transcription control
If using a real-time PCR assay to quantify mRNA, then an important control
is a reaction that allows one to assess the amount of genomic contamina-
tion in the sample. This control is commonly referred to as the minus
reverse transcription (−RT) control. It is a sample of starting RNA that is
treated identically to all the samples, but has no reverse transcriptase added
during the reverse transcription step. How important this control is to the
experiment and whether it is needed to include this control in every exper-
iment is dependent upon the genes being examined and how the
primer/probes were designed. What if the –RT control is positive? There are
several strategies for eliminating or minimizing genomic detection. Some
advocate designing primer/probed sets that span introns. Try to span a large
intron rather than a small one. Some introns are less than 100 base pairs
and could compete with the designated amplicon. Spanning an intron-
exon border is not always possible, as with single exon genes and those with
pseudogenes. Treating the samples with DNase is a good method to remove
the majority of genomic DNA contamination from a RNA sample and is
generally recommended. DNase treatment, however, usually reduces RNA
yields, and this may be undesirable in the case where small numbers of cells
are analyzed. If DNase treatment is not possible and the primer/probe set
does not span an intron, a –RT control should always be included.
Positive control
There are several types of positive controls, but one of the best is a standard
curve. The merits of using a standard curve have been discussed earlier in
this chapter. If using a standard curve for quantification, check the slope
and the y-intercept to be sure that the standard is not deteriorating. If it is
not possible to include an artificial standard curve for each primer/probe
set, then a standard curve over a smaller range using genomic DNA or a
universal RNA or a known positive sample as a template should be included
to monitor the efficiency of the assay. Include a single positive sample if a
standard curve isn’t possible. If the situation arises where there is no ampli-
fication in the test samples, then having a positive control will aid in
troubleshooting the problem and narrowing down the possibilities to
reagent versus template problems.
56 Real-time PCR
Figure 2.10
Two differently labeled probes. A. Amplification view showing a probe labeled
with FAM/BHQ1 (a) and a MGB probe from an Applied Biosystems Gene
Expression Assay (b). B. The same in the Raw Spectra view. C. Multicomponent
view of sample a. D. Multicomponent view representative of one of the b
sample wells.
2.3.5 Experimental samples
The baseline is acceptable, the threshold is adjusted properly, the NTCs are
negative, the positive control is good – now you are ready to look at the
samples. First, look at the amplification curves. What is the ΔRn at the
plateau? If the ΔRn is not greater than 0.5, then there may not be real ampli-
fication. The amplitude of the ΔRn depends upon several factors. One
important factor is the probe. Each probe may perform differently and have
different maximum ΔRn values. The type of probe and what it is labeled
with can affect the ΔRn substantially as can the type of master mix that is
being used. Figure 2.10A, shows an example of the two different ΔRn
plateaus that are obtained using a 5’ FAM, 3’ BHQ1 probe (Biosearch
Technologies, Novato, CA, USA) and a MGB probe from a commercial Gene
Expression assay (Applied Biosystems, Foster City, CA, USA). Checking the
Raw Spectra view after 40 cycles of amplification (Figure 2.10B) reveals that
there is a substantial difference in the raw fluorescence generated by each
probe. Further investigation into the Multicomponent view (Figure 2.10C
and 2.10D) demonstrates that even though the raw fluorescence values are
quite different, there is exponential amplification using both probes. As
long as the threshold is set so that it is in the exponential phase of both sets
of curves, analysis should be valid.
Data analysis and reporting 57
Look at the samples’ curves again. Are all the curves exponential or are
there some curves that run parallel to the threshold before becoming
exponential? This can happen when the ROX is gradually dropping, as
discussed in the NTC section and demonstrated in Figure 2.9A. Curve b. It is
also possible to have a run with no real amplification that looks like there
are amplification curves. The software will do its best to make curves.
However, if the ΔRn is much less than 1, then it should immediately be
suspected that no real amplification has taken place even though it looks
like curves have been generated. Figure 2.9A. Curve c, which has already
been described in the NTC section, demonstrates this situation. If a good
positive control was included, then it should be easy to distinguish real
amplification from machine artifacts.
Check the replicates next. They should be within 0.5 Ct of each other.
Determine the coefficient of variance. What is the coefficient of variance
(CV)? The CV is the standard deviation (SD) divided by the arithmetic mean
and is used to measure intra-assay reproducibility from well to well and is
also useful to measure inter-assay variation from assay to assay. If the CV for
the samples is small, then there is no problem. What if one well is different
from the others? Hopefully, triplicates were run. Here again, the
Multicomponent view or Raw Spectra view is useful. If there was no ampli-
fication, check for the presence of the probe fluorescence. Maybe the probe
did not get added? If there is no sign of probe fluorescence, then this would
be a legitimate reason to exclude this data. If the probe is present, but there
is no sign of amplification, perhaps no template was added. Similarly, if the
aberrant well has a lower Ct, then perhaps template was added twice. Of
course, adding template to the same well twice would only decrease the Ct
by one, so if the CV is large, this phenomena would not be detected.
Another scenario is that the plate was not sealed tightly and there has been
evaporation in one or more of the wells/tubes. The Multicomponent view
might show all fluorescent compounds increasing over the course of the
run due to evaporation. Using genomic DNA as a template can be especially
problematic for getting identical replicates and careful attention needs to be
paid to mixing between every aliquot. If dealing with samples that have low
expression and therefore a very high Ct, then the Monte Carlo effect should
be considered. Try to run triplicates and run the same experiment three
times if possible, to gain statistical significance for the results (Bustin and
Nolan, 2004b). As a general rule, the more replicate reactions there are, and
the lower the CV of the replicates, the better the ability to discriminate
between samples.
2.3.6 Quantifying data
Once the initial examination and analysis of the preliminary data have
been completed, the next step is to decide how to compare the data in a
meaningful manner. Figure 2.11 illustrates the general concepts of
secondary analysis. Normalization and relative quantification are extensive
topics that are covered in other chapters. Using a standard curve for quanti-
fying mRNA or DNA is sometimes referred to as absolute quantification, but
the term absolute is debatable since it is only as accurate as the measure-
ment of the material used for the standard curve. This method is better
58 Real-time PCR
Secondary analysis flowchart
Quantification
‘Absolute’ quantification Relative quantification
using an external standard compared with other gene(s)
Normalize data
Adjusted for efficiency Not adjusted for efficiency
REST, Q-Gene, DART ΔΔCt
Graphical, tabular representation
Statistics
Figure 2.11
Flow chart for secondary analysis. Suggested steps for analysis of real-time PCR
data after the preliminary data has been verified.
referred to as quantification using a standard curve. The standard curve
allows the amount of unknown samples to be computed on a per cell or
unit mass basis. But, no matter how accurately the concentration of the
standard material has been determined, the final result is relative to a
defined unit of interest (Pfaffl, 2004).
The characteristics of a standard curve are shown in Figure 2.1 and
described in the section on standard curves. Most real-time instruments
have software that will calculate the amount of unknown values in the
same units designated in the standard curve, but unknowns can be calcu-
lated in a spreadsheet using the formula:
Log10 copy number = Ct – y-intercept/slope
It is important to remember that verifying your reagents are capable of
giving a 100% efficient reaction, as described in the section on standard
curves earlier in this chapter, does not necessarily mean that particular
template will give an accurate measure of gene expression in your sample.
Using a defined template, such as a plasmid, PCR product or synthetic
Data analysis and reporting 59
oligonucleotide, while easy to prepare, does not take into account the
sample preparation and reverse transcription step. Transcribed RNA can be
used to control for the reverse transcription step, but it does not control for
template preparation and is quite labor intensive. Genomic DNA can be
used for the standard curve and may be a more realistic control for sample
preparation, but is only useful if the primer/probe set are designed within
one exon. Obviously, there is not one perfect method for quantification. Be
aware of the pitfalls and choose the method which is best suited to your
goals.
2.4 Data reporting and statistics
The experiment is complete, the data have been analyzed, now what should
be done?
There are a huge number of variables associated with real-time PCR
assays. Variation is introduced by harvesting procedures, nucleic acid
extraction techniques, reverse transcription, PCR conditions, reagents, etc.
For this reason, data reporting and statistics are important steps in prepar-
ing your results for peer review. Data presentation is dependent upon the
type of experiment. For example, experimental protocols might examine
relative gene expression before and after treatment, normal versus tumor,
time courses, responses to inflammation or disease. Other experiments
might measure the quantity or strain of organisms in food, water, or the
environment. Validations of microarray and siRNA results are other
common uses for real-time PCR technology. Regardless of the type of exper-
iment, data should be presented in a manner which allows the reader to
observe the amount of variation inherent to the experiment; for example,
mean, standard deviation and confidence intervals. Some sort of statistical
analysis should be performed to apprise the reader of probabilities of differ-
ences being significant. Most real-time PCR experiments are based on
hypothesis testing. What is the probability that randomly selected samples
have a difference larger than those observed? In some situations, the differ-
ences in data are obvious and statistics are a formality. But because biologi-
cal systems are subject to variation and experimental imprecision,
sometimes statistics can reveal differences that are not otherwise
discernible, especially if there are a large amount of data. Ideally, an exper-
iment should be planned with a statistical analysis in mind. Large studies
should be planned with the advise of a statistician.
If statistical and bioinformatics resources are limited, then there are
several choices. Freely available software packages for this purpose include
Q-Gene (Muller et al., 2002), DART-PCR (Peirson et al, 2003) and REST
(relative expression software) (or REST-XL) (Pfaffl et al., 2002). These and
other software are presented in detail in Chapter 3. For a more generic
approach, a wise investment is to purchase some type of software for report-
ing data and performing statistical analyses that allows both functions to be
performed using the same software.
One such package is Graphpad Prism® (Graphpad Software Inc., San
Diego, CA, USA). This software provides many data presentation choices,
handbooks to explain basic statistics (Statistics Guide: Statistical analyses for
Laboratory and Clinical Researchers, Fitting Models to Biological Data using Linar
60 Real-time PCR
A B
C D
Figure 2.12
Examples of data reporting. The data for each panel is the same representing
the real-time PCR results for four different treatments. NTC = No template
control. A. Scatter plot of individual data points with the mean shown as a bar.
B. Box and whisker plot: box extends from the 25th to 75th percentile with a
line at the median. Whiskers extend to show the highest and lowest value.
C. Bar graph of the mean and standard deviation for each group. D. Mean of
each group plotted as a single point +/– standard deviation.
and Nonlinear Regression) and automatic performance of a wide variety of
statistical analyses. Prism® provides checklists to help the user decide which
is the correct statistical analysis and even describes the best way to cite statis-
tical analyses. With a few basic concepts understood, the mathematics can
be left to the software. A good general review of statistics and how they
might apply to real-time PCR can be found in A–Z of Quantitative PCR edited
by Stephen Bustin. Figure 2.12 shows several different methods of presenting
the same data. Scatter plots (Figure 2.12A) allow the reader to see the indivi-
dual data points and the number of samples in each group (n) is readily
apparent. A box and whiskers plot (Figure 2.12B) conveys data about the
mean, the 25th and 75th quartile values and the highest and lowest value in
the group. Some prefer bar graphs or single means with the standard
deviation (Figure 2.12C and 12D). Be sure to use the standard deviation (SD)
Data analysis and reporting 61
Table 2.2 One-way analysis of variance of the data graphically represented in Figure 2.11
demonstrating the calculation of P values between groups
P value P<0.0001
Are means significantly different?
(P <0.05) Yes
Number of groups 5
F 46.4
R squared 0.9391
ANOVA table SS df MS
Treatment (between columns) 436.7 4 109.2
Residual (within columns) 8.712 10 0.8712
Total 445.4 14
99% CI of
Tukey’s multiple comparisons test MD q P value difference
A vs. B 7.218 7.961 P <0.001 1.93 to 12.51
A vs. C –0.6567 0.7242 P >0.05 –5.95 to 4.64
A vs. D –3.67 3.786 P >0.05 –9.38 to 1.99
A vs. NTC –9.697 10 P <0.001 –15.35 to –4.04
B vs. C –7.875 9.381 P <0.001 –12.77 to –2.98
B vs. D –10.89 12.01 P <0.001 –16.18 to –5.60
B vs. NTC –16.92 18.66 P <0.001 –22.21 to –11.62
C vs. D –3.013 3.323 P >0.05 –8.31 to 2.28
C vs. NTC –9.04 9.97 P <0.001 –14.33 to –3.75
D vs. NTC –6.027 6.217 P <0.01 –11.68 to –0.37
and not the standard error of the mean (SEM) because the standard devia-
tion is a better indicator of how much variability there is in the data. A statis-
tical analysis using a one-factor, analysis of variance (ANOVA) and Tukey’s
multiple comparison test was performed on the data in graphically repre-
sented in Figure 2.12 and the results are shown in Table 2.2.
Statistics are important but must be tempered with scientific and/or clini-
cal experience. Remember that statistical significance and biological
relevance may not be directly correlated.
Acknowledgments
Many thanks to Dr Deborah Grove, Brian Holloway, Karen McCaustland,
Dr Greg Shipley, Dr Tony Yeung and Dr Stephen Bustin.
References
Bustin SA, Nolan T (2004a) Pitfalls of quantitative real-time reverse-transcription
polymerase chain reaction. J Biomol Tech 15: 155–166.
Bustin SA, Nolan T (2004b) Data analysis and interpretation. In: A–Z of Quantitative
PCR (ed Bustin, SA) pp 441–492. International University Line, La Jolla, CA.
Muller PY, Janovjak H, Miserez AR, Dobbie Z (2002) Processing of gene expression
data generated by quantitative real-time RT-PCR. Biotechniques 32(6):
1372–1378.
62 Real-time PCR
Peirson SN, Butler JB, Foster RG (2003). Experimental validation of novel and
conventional approaches to quantitative real-time PCR data analysis. Nucleic
Acids Res 31(14): e73.
Pfaffl M (2004) Quantification strategies in real-time PCR. In: A–Z of Quantitative PCR
(ed Bustin SA) pp 441–492. International University Line, La Jolla, CA.
Pfaffl M, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for
group-wise comparison and statistical analysis of relative expression results in
real-time PCR. Nucleic Acids Res 30(9): E36.
Relative quantification
Michael W. Pfaffl 3
3.1 Introduction
Reverse transcription (RT) followed by a polymerase chain reaction (PCR)
represents the most powerful technology to amplify and detect trace
amounts of mRNA (Heid et al., 1996; Lockey, 1998). To quantify these low
abundant expressed genes in any biological matrix the real-time quantita-
tive RT-PCR (qRT-PCR) is the method of choice. Real-time qRT-PCR has
advantages compared with conventionally performed ‘semi-quantitative
end point’ RT-PCR, because of its high sensitivity, high specificity, good
reproducibility, and wide dynamic quantification range (Higuchi et al.,
1993; Gibson et al., 1996; Orland et al., 1998; Freeman et al., 1999;
Schmittgen et al., 2000; Bustin, 2000). qRT-PCR is the most sensitive and
most reliable method, in particular for low abundant transcripts in tissues
with low RNA concentrations, partly degraded RNA, and from limited tissue
sample (Freeman et al., 1999; Steuerwald et al., 1999; Mackay et al., 2002).
While real-time RT-PCR has a tremendous potential for analytical and
quantitative applications in transcriptome analysis, a comprehensive
understanding of its underlying quantification principles is important.
High reaction fidelity and reliable results of the performed mRNA quantifi-
cation process is associated with standardized pre-analytical steps (tissue
sampling and storage, RNA extraction and storage, RNA quantity and
quality control), optimized RT and PCR performance (in terms of speci-
ficity, sensitivity, reproducibility, and robustness) and exact post-PCT data
procession (data acquisition, evaluation, calculation and statistics) (Bustin,
2004; Pfaffl, 2004; Burkardt, 2000).
The question which might be the ‘best RT-PCR quantification strategy’ to
express the exact mRNA content in a sample has still not been answered to
universal satisfaction. Numerous papers have been published, proposing
various terms, like ‘absolute’, ‘relative’, or ‘comparative’ quantification.
Two general types of quantification strategies can be performed in qRT-
PCR. The levels of expressed genes may be measured by an ‘absolute’
quantification or by a relative or comparative real-time qRT-PCR (Pfaffl,
2004). The ‘absolute’ quantification approach relates the PCR signal to
input copy number using a calibration curve (Bustin, 2000; Pfaffl and
Hageleit, 2001; Fronhoffs et al., 2002). Calibration curves can be derived
from diluted PCR products, recombinant DNA or RNA, linearized plasmids,
or spiked tissue samples. The reliability of such a an absolute real-time RT-
PCR assay depends on the condition of ‘identical’ amplification efficiencies
64 Real-time PCR
for both the native mRNA target and the target RNA or DNA used in the
calibration curve (Souaze et al., 1996; Pfaffl, 2001). The so-called ‘absolute’
quantification is misleading, because the quantification is shown relative to
the used calibration curve. The mRNA copy numbers must be correlated to
some biological parameters, like mass of tissue, amount of total RNA or
DNA, a defined amount of cells, or compared with a reference gene copy
number (e.g. ribosomal RNA, or commonly used house keeping genes
(HKG)). The ‘absolute’ quantification strategy using various calibration
curves and applications are summarized elsewhere in detail (Pfaffl and
Hageleit, 2001; Donald et al., 2005; Lai et al., 2005; Pfaffl et al., 2002).
This chapter describes the relative quantification strategies in quantita-
tive real-time RT-PCR with a special focus of relative quantification models
and newly developed relative quantification software tools.
3.2 Relative quantification: The quantification is relative
to what?
Relative quantification or comparative quantification measures the relative
change in mRNA expression levels. It determines the changes in steady-
state mRNA levels of a gene across multiple samples and expresses it relative
to the levels of another RNA. Relative quantification does not require a
calibration curve or standards with known concentrations and the reference
can be any transcript, as long as its sequence is known (Bustin, 2002). The
units used to express relative quantities are irrelevant, and the relative
quantities can be compared across multiple real-time RT-PCR experiments
(Orlando et al., 1998; Vandesompele et al., 2002; Hellemans et al., 2006). It
is the adequate tool to investigate small physiological changes in gene
expression levels. Often constant expressed reference genes are chosen as
reference genes, which can be co-amplified in the same tube in a multiplex
assay (as endogenous controls) or can be amplified in a separate tube (as
exogenous controls) (Wittwer et al., 2001; Livak, 1997, 2001; Morse et al.,
2005). Multiple possibilities are obvious to compare a gene of interest (GOI)
mRNA expression to one of the following parameters. A gene expression
can be relative to:
• an endogenous control, e.g. a constant expressed reference gene or
another GOI
• an exogenous control, e.g. an universal and/or artificial control RNA or
DNA
• an reference gene index, e.g. consisting of multiple averaged endoge-
nous controls
• a target gene index, e.g. consisting of averaged GOIs analyzed in the
study
To determine the level of expression, the differences (Δ) between the
threshold cycle (Ct) or crossing points (CP) are measured. Thus the mentioned
methods can be summarized as the ΔCP methods (Morse et al., 2005; Livak
and Schmittgen, 2001). But the complexity of the relative quantification
procedure can be increased. In a further step a second relative parameter can
be added, e.g. comparing the GOI expression level relative to:
Relative quantification 65
• a nontreated control
• a time point zero
• healthy individuals
These more complex relative quantification methods can be summarized
as ΔΔCP methods (Livak and Schmittgen, 2001).
3.3 Normalization
To achieve optimal relative expression results, appropriate normalization
strategies are required to control for experimental error (Vandesompele et
al., 2002; Pfaffl et al., 2004), and to ensure identical cycling performance
during real-time PCR. These variations are introduced by various processes
required to extract and process the RNA, during PCR set-up and by the
cycling process. All the relative comparisons should be made on a constant
basis of extracted RNA, on analyzed mass of tissue, or an identical amount
of selected cells (e.g. microdissection, biopsy, cell culture or blood cells)
(Skern et al., 2005). To ensure identical starting conditions, the relative
expression data have to be equilibrated or normalized according to at least
one of the following variables:
• sample size/mass or tissue volume
• total amount of extracted RNA
• total amount of genomic DNA
• reference ribosomal RNAs (e.g. 18S or 28S rRNA)
• reference messenger RNAs (mRNA)
• total amount of genomic DNA
• artificial RNA or DNA molecules (= standard material)
But the quality of normalized quantitative expression data cannot be
better than the quality of the normalizer itself. Any variation in the normal-
izer will obscure real changes and produce artefactual changes (Bustin,
2002; Bustin et al., 2005).
It cannot be emphasized enough that the choice of housekeeping or
lineage specific genes is critical. For a number of commonly used reference
genes, processed pseudogenes have been shown to exist, e.g. for β-actin or
GAPDH (Dirnhofer et al., 1995; Ercodani et al., 1988). Pseudogenes may be
responsible for specific amplification products in a fully mRNA indepen-
dent fashion and result in specific amplification even in the absence of
intact mRNA. It is vital to develop universal, artificial, stable, internal
standard materials, that can be added prior to the RNA preparation, to
monitor the efficiency of RT as well as the kinetic PCR respectively (Bustin,
2002). Usually more than one reference gene should be tested in a multiple
pair-wise correlation analysis and a summary reference gene index be
obtained (Pfaffl et al., 2004). This represents a weighted expression of at
least three reference genes and a more reliable basis of normalization in
relative quantification can be postulated.
There is increasing appreciation of these aspects of qRT-PCR software
tools were established for the evaluation of reference gene expression levels.
geNorm (Vandesompele et al., 2002) and BestKeeper (Pfaffl et al., 2004) allows
66 Real-time PCR
for an accurate normalization of real-time qRT-PCR data by geometric
averaging of multiple internal control genes (http://medgen.ugent.be/
~jvdesomp/genorm). The geNorm Visual Basic applet for Microsoft Excel®
determines the most stable reference genes from a set of 10 tested genes in
a given cDNA sample panel, and calculates a gene expression normalization
factor for each tissue sample based on the geometric mean of a user defined
number of reference genes. The normalization strategy used in geNorm is a
prerequisite for accurate kinetic RT-PCR expression profiling, which opens
up the possibility of studying the biological relevance of small expression
differences (Vandesompele et al., 2002). These normalizing strategies are
summarized and described in detail elsewhere (Huggett et al., 2005;
LightCycler® Relative Quantification Software, 2001).
3.4 Mathematical models
The relative expression of a GOI in relation to another gene, mostly to an
adequate reference gene, can be calculated on the basis of ‘delta Cp’ (ΔCp,
24) or ‘delta delta Ct’ (ΔΔCt) values (Livak and Schmittgen, 2001). Today
various mathematical models are established to calculate the relative
expression ratio (R), based on the comparison of the distinct cycle differ-
ences. The CP value can be determined by various algorithms, e.g. CP at a
constant level of fluorescence or CP acquisition according to the established
mathematic algorithm (see Section 3.6).
Three general procedures of calculation of the relative quantification
ratio are established:
1. The so-called ‘delta Ct’ (eqs. 1–2 using ΔCP) or ‘delta-delta Ct’ method
(eqs. 3–4 using ΔΔCP) without efficiency correction. Here an optimal
doubling of the target DNA during each performed real-time PCR cycle
is assumed (Livak, 1997, 2001; Livak and Schmittgen, 2001). Such
expression differences on basis of ΔCP values are shown in Figure 3.1.
R = 2[CP sample – CP control] (eq. 1)
R = 2ΔCP (eq. 2)
R = 2–[ΔCP sample – ΔCP control] (eq. 3)
R = 2–ΔΔCP (eq. 4)
2. The efficiency corrected calculation models, based on ONE sample (eqs.
5–6) (Souaze et al., 1996; LightCycler® Relative Quantification Software,
2001) and the efficiency corrected calculation models, based on MULTI-
PLE samples (eqs. 7) (Pfaffl, 2004).
(Etarget)ΔCP target (control – sample)
ratio = ᎏᎏᎏ (eq. 5)
(ERef)ΔCP Ref (control – sample)
(ERef)CP sample (ERef)CP calibrator
ratio = ᎏᎏ ÷ ᎏᎏ (eq. 6)
(Etarget)CP sample (Etarget)CP calibrator
Relative quantification 67
80.0
75.0 GAPDH (control)
70.0 GAPDH (treatment)
65.0 TNFa (control)
60.0 TNFa (treatment)
55.0 analysis line
50.0
Fluorescence
45.0
40.0
35.0
30.0
25.0
20.0
15.0
10.0
.5.0
0.0
–5.0
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycle number
Figure 3.1
Effect of LPS treatment of TNFα target gene expression and on GAPDH
reference gene expression in bovine white blood cells. Expression differences are
shown by ΔCP values.
(Etarget)ΔCP target (MEAN control – MEAN sample)
ratio = ᎏᎏᎏᎏ (eq. 7)
(ERef)ΔCP Ref (MEAN control – MEAN sample)
3. An efficiency corrected calculation models, based on MULTIPLE sample
and on MULTIPLE reference genes, so-called REF index, consisting at
least of three reference genes (eq. 8) (Pfaffl, 2004).
(Etarget)ΔCP target (MEAN control – MEAN sample)
R = ᎏᎏᎏᎏᎏ (eq. 8)
(ERef index)ΔCP Ref index (MEAN control – MEAN sample)
In these models, the target-gene expression is normalized by one or more
non-regulated reference gene (REF) expression, e.g., derived from classical
and frequently described reference genes (Bustin, 2000; Vandesompele et
al., 2002; Pfaffl et al., 2005). The crucial problem in this approach is that the
most common reference-gene transcripts from so-called stable expressed
housekeeping gene are influenced by the applied treatment. The detected
mRNA expressions can be regulated and these levels vary significantly
during treatment, between tissues and/or individuals (Pfaffl, 2004;
Schmittgen and Zakrajsek, 2000).
Thus always one question appears: which is the right reference to normal-
ize with and which one(s) is (are) the best housekeeping- or reference
gene(s) for my mRNA quantification assay? Up to now no general answer
can be given. Each researcher has to search and validate each tissue and
treatment analyzed for its own stable expressed reference genes. Further,
68 Real-time PCR
each primer and probe combination, detection chemistry, tubes and the
real-time cycler platform interfere with the test performance. However,
qRT-PCR is influenced by numerous variables and appears as a multi-
factorial reaction. Thus, relative quantification must be highly validated to
generate useful and biologically relevant information.
The main disadvantage of using reference genes as external standards is
the lack of internal control for RT and PCR inhibitors. All quantitative PCR
methods assume that the target and the sample amplify with similar
efficiency (Wittwer et al., 2001; Livak and Schmittgen, 2001). The risk with
external references is that some analyzed samples may contain substances
that significantly influence the real-time PCR amplification efficiency of the
PCR reaction. As discussed earlier (Pfaffl, 2004), sporadic RT and PCR
inhibitors or enhancers can occur.
3.5 Real-time qPCR amplification efficiency
Each analyzed sample generates an individual amplification history during
real-time fluorescence analysis. As we know from laboratory practice, bio-
logical replicates, even technical replicates, result in significantly different
fluorescence curves as a result of sample-to-sample variations (Figure 3.2).
Changing PCR efficiencies are caused by RT and PCR inhibitors or
enhancers, and by variations in the RNA pattern extracted. Thus the shapes
of fluorescence amplification curves differ in the background level (noisy,
constant or increasing), the take-off point (early or late), the steepness (good
50
40
Fluorescence (linear)
30
20
10
0
0 10 20 30 40 50
Cycles
Figure 3.2
Variation of fluorescence amplification plot of three different genes run in
quadruplicates.
Relative quantification 69
or bad efficiency), the change-over to the plateau phase (quick or steady),
and in the appearance of the PCR plateau (constant, in or decreasing trend)
(Tichopad et al., 2003; Tichopad et al., 2004). The PCR amplification
efficiency bears the biggest impact on amplification kinetics and is critically
influenced by PCR reaction components. Therefore CP determination of the
threshold level and in consequence the accuracy of the quantification results
are influenced by the amplification efficiency. The efficiency evaluation is
an essential marker and the correction is necessary in real-time gene
quantification (Rasmussen, 2001; Liu and Saint, 2002a; Liu and Saint, 2002b;
Tichopad et al., 2003; Meijerink et al., 2001).
A constant amplification efficiency in all compared samples is one impor-
tant criterion for reliable comparison between samples. This becomes
crucially important when analyzing the relationship between an unknown
and a reference sequence, which is performed in all relative quantification
models. In experimental designs employing standardization with reference
genes, the demand for invariable amplification efficiency between target
and standard is often ignored, despite the fact that corrections have been
suggested in the recent literature (Pfaffl, 2001; Pfaffl et al., 2002; Liu and
Saint, 2002a; Liu and Saint, 2002b; Soong et al., 2000; Wilhelm et al., 2003).
A correction for efficiency, as performed in efficiency corrected mathe-
matical models (eqs. 5–8), is strongly recommended and results in a more
reliable estimation of the ‘real’ expression changes compared with NO
efficiency correction. Even small efficiency differences between target and
reference generate false expression ratio, and the researcher over- or under-
estimates the initial mRNA amount. A theoretic difference in qPCR
efficiency (ΔE) of 3% (ΔE = 0.03) between a low copy target gene and
medium copy reference gene generate falsely calculated differences in
expression ratio of 242% in case of Etarget > Eref after 30 performed cycles. This
gap will increase dramatically by higher efficiency differences ΔE = 0.05
(432%) and ΔE = 0.10 (1,744%). The assessment of the sample specific
efficiencies must be carried out before any relative calculation is done. Some
tools are available to correct for efficiency differences. The LightCycler®
Relative Expression Software (2001), Q-Gene (Muller et al., 2002), qBase
(Hellmans et al., 2006), SoFar (Wilhelm et al., 2003), and various REST
software applications (LightCycler® Relative Quantification Software, 2001;
Pfaffl et al., 2002; Pfaffl and Horgan, 2002; Pfaffl and Horgan, 2005) allow
the evaluation of amplification efficiency plots. In most of the applications
a triplicate determination of real-time PCR efficiency for every sample is
recommended. Therefore efficiency corrections should be included in the
relative quantification procedure and the future software applications
should calculate automatically the qPCR efficiency (Pfaffl, 2004).
3.6 Determination of the amplification rate
Up to now only one software package can automatically determine the real-
time PCR efficiency sample-by-sample. In the Rotor-Gene™ 3000 software
package (Corbett Research), it is called the comparative quantification.
Amplification rate is calculated on the basis of fluorescence increase in the
PCR exponential phase. Further algorithms and methods are described in
recent publications to estimate the real-time PCR efficiency. These can be
70 Real-time PCR
grouped in direct and indirect methods. Direct methods are based on either
a dilution method or a measurement of the relative fluorescence increase in
the exponential phase. On the other hand, indirect methods are published,
doing the efficiency calculation on basis of a fit to a mathematical model,
like sigmoidal, logistic models or an exponential curve fitting (for details see
http://efficiency.gene-quantification.info).
3.6.1 Dilution method
The amplification rate is calculated on the basis of a linear regression slope
of a dilution row (Figure 3.3). Efficiency (E) can be determined based on
eq. 9 (Higuchi et al., 1993; Rasmussen, 2001). But the real-time PCR
efficiency should be evaluated sample-by-sample, which is quite laborious
and costly, wastes template, and takes time if the dilution method is used.
Alternatively, the pool of all sample RNAs can be used to accumulate all
possible ‘positive and negative impacts’ on kinetic PCR efficiency. Applying
the dilution method, usually the efficiency varies in a range of E = 1.60 to
values over 2 (Figure 3.3) (Souaze et al., 1996).
E = 10 [–1/slope] (eq. 9)
Typically, the relationship between CP and the logarithm of the starting
copy number of the target sequence should remain linear for up to five
orders of magnitude in the calibration curve as well as in the native sample
35
䊉 ng cDNA vs. gene 1; slope = –3.108; E = 2.09
䉲 ng cDNA vs. gene 2; slope = –2.986; E = 2.16
Cycle number of crossing point (CP)
30 䊏 ng cDNA vs. reference; slope = –3.342; E = 1.99
䊉 regressions
䊉
25
䉲
䊏 䊉
䉲 䊉
䊏 䊉
20 䉲
䊏 䉲
䊏
15 䉲
䊏
10
0.025 0.05 0.1 0.25 0.5 1 2.5 5 10 25 50
cDNA input (ng)
Figure 3.3
On the basis of a dilution row the real-time efficiency is calculated according to
eq. 9 (Higuchi et al., 1993; Rasmussen, 2001).
Relative quantification 71
RNA (Muller et al., 2002). The advantage of the dilution method is that it is
highly reproducible and constant within one transcript and tissue. The
disadvantage of this approach is the high efficiencies, often higher than two
(E > 2.0), which is practically impossible on the basis of the PCR amplifica-
tion theory. This indicates that this efficiency estimation is more or less not
the best one and it will overestimate the ‘real’ amplification efficiency.
3.6.2 Fluorescence increase in exponential phase
Efficiency calculation from the fluorescence increases in the exponential
phase of fluorescence history plot (in log. scale) (Figure 3.4). Fitting can be
done by eye, or more reliably by software applications like LinRegPCR
(Ramakers et al., 2003) or DART-PCR (Peirson et al., 2003). The investigator
has to decide which fluorescence data to include in the analysis and which
to omit. A linear regression plot is drawn from at least four data points,
where the slope of the regression line represents the PCR efficiency.
Therefore this method is more or less arbitrary and dependent on the
chosen data points. Resulting efficiencies range between E = 1.45, and
E = 1.90, and seem more realistic than the results mentioned above. This
efficiency calculation method might be good estimator for the ‘real
efficiency,’ because data evaluation is made exclusively in exponential
phase.
The advantage of both direct methods is the independency of the
background fluorescence. We know from several applications that a rising
100 plateau phase
80 inter phase cycle 22–40
cycle 15–21
60
exponential phase
40 cycle 9–14
Fluorescence (log10)
20 background phase
cycle 1–8
10
8
6
0 5 10 15 20 25 30 35 40
Cycles
Figure 3.4
Efficiency calculation in the exponential phase.
72 Real-time PCR
trend in the background fluorescence will interfere with the indirect curve
fit, like sigmoidal, logistic and exponential models. Probe based detection
in particular exhibits high and noisy background levels, whereas SYBR®
Green I applications show low and constant background fluorescence
(Figure 3.5).
3.6.3 Sigmoidal or logistic curve fit
A number of publications have suggested an efficiency calculation on the
basis of all fluorescence data points (starting at cycle 1 up to the last cycle),
according to a sigmoidal or logistic curve fit model (Tichopad et al., 2003;
Tichopad et al., 2004; Liu and Saint, 2002a; Liu and Saint, 2002b; Rutledge,
2004). The advantage of such models is that all data points will be included
in the calculation process and no background subtraction is necessary. The
efficiency will be calculated at the point of inflexion (cycle 27.06 shown in
Figure 3.5) at absolute maximum fluorescence increase.
a
f(x) = y0 + ᎏ x–x
– ᎏᎏ0 (eq. 10)
1+e( b )
In the four-parametric sigmoid model (eq. 10), x is the cycle number, f(x)
is the computed function of the fluorescence in cycle number x, y0 is the
background fluorescence, a is the difference between maximal fluorescence
reached at plateau phase and background fluorescence (i.e. the plateau
height), e is the natural logarithm base, x0 is the co-ordinate of the first
derivative maximum of the model or inflexion point of the curve, and b
describes the slope at x0 in the log–linear phase (Tichopad et al., 2004). But
Figure 3.5
Efficiency calculation on the basis of a four-parametric sigmoid model (eq. 10).
Relative quantification 73
the derived slope parameters generated by the sigmoidal or logistic models,
e.g. b, can not directly compared with the ‘real PCR efficiency.’ The advan-
tages of the four-parametric sigmoid model is that it is easy to perform, is a
good estimator for the maximum curve slope with high correlation between
replicates (r > 0.99) and the algorithm can easily implemented in analysis
software. The resulting efficiencies are comparable to the latter method and
range from 1.35 to 1.65.
3.6.4 Efficiency calculation in the exponential phase using
multiple models
Here we describe the efficiency calculation in the exponential phase using
multiple models, first, a linear, second, a logistic and third, an exponential
model (Tichopad et al., 2003). The background phase is determined with
the linear model using studentized residual statistics. The phase until the
second derivative maximum (SDM) of the logistic fit exhibits a real
exponential amplification behavior (Figure 3.6). The phase behind includ-
ing the first derivative maximum (FDM) shows suboptimal and decreasing
amplification efficiencies and therefore has to be excluded from the
analysis. Efficiency calculation is only performed between the background
and before SDM. Here an exponential model according to a polynomial
curve fit is performed, according to eq. 11.
Yn = Y0 (E)n (eq. 11)
exponential fit
䉲䉲 䉲䉲 䉲䉲䉲
䉲䉲 䉲 䉲
䉲䉲
30 䉲 logistic fit
䉲
䉲
䉲
20
Fluorescence (f)
䉲
FDM
logistic fit n = 40 䉲
䊉 linear ground phase
10
䊉 early exponent. phase
䉲
䉲 log-linear phase n = 6 SDM
䉲 plateau phase n = 14
䊉
linear fit n = 11
exponential fit n = 9 䊉 linear fit
䊉
䊉
䊉 䊉䊉䊉 䊉 䊉䊉 䊉䊉䊉 䊉䊉 䊉䊉 䊉 䊉
0
0 10 20 30 40
Cycle
Figure 3.6
Efficiency calculation in the exponential phase using multiple model fitting:
linear, logistic and exponential model (Tichopad et al., 2003).
74 Real-time PCR
In the polynomial model, Yn is fluorescence acquired at cycle n, and Y0
initial fluorescence, and E represents the efficiency. Here in the exponential
part of the PCR reaction, kinetic is still under ‘full amplification power’ with
no restrictions. The calculation is performed on each reaction kinetic plot
and the amplification efficiency can be determined exactly. They range
from E = 1.75 to E = 1.90, in agreement with the other methods.
A comparable multi-factorial model is used in the SoFAR software appli-
cation (Wilhelm et al., 2003). Here the background is corrected by a least
square fit of the signal curve. Efficiency is determined by an exponential
growth function (eq. 11) or a logistic or sigmoidal fit (eq. 10). The sigmoidal
exponential function was the most precise one and could increase the
amplification efficiency, before and after correction, from around 62% up
to 82% (Wilhelm et al., 2003).
All models lead to efficiency estimates, but which model results in the
‘right’, most accurate and realistic real-time amplification efficiency
estimate has to be evaluated in further experiments. From our experiment
we know that the detection chemistry, the type of tubes (plastic tubes or
glass capillaries), the cycling platform as well the optical system has consid-
erable influence on the estimates of real-time efficiency. Better dyes and
much more sensitive optical and detection systems are needed to guarantee
a reliable efficiency calculation. In Table 3.1 an overview of the existing
efficiency calculation methods is shown.
Table 3.1 Overview of existing efficiency calculation methods.
Summary Sample Overestimation + Combination of
individual Intermediate Ø efficiency and
determination Underestimation – CP determination
Dilution series (fit point or SDM) no + n = 3–5
Rasmussen (2001)
Fluorescence increase + – n = 3–6
Various authors
Fluorescence increase + – n = 3
Peccoud and Jacob (1996)
Sigmoidal model + – n = 1 +
Lui and Saint (2002a, 2002b)
Tichopad et al. (2004)
Wilhelm et al. (2003)
Rutledge (2004)
LinRegPCR + Ø n = 4–6
Ramakers et al. (2003)
KOD + Ø n = 3–5
Bar et al. (2003)
Logistic model + Ø n > 7 +
Tichopad et al. (2003)
Wilhelm et al. (2003)
Rotor-Gene™ 3000 + Ø n = 4 +
Comparative quantitation analysis
Relative quantification 75
3.7 What is the right crossing point to determine?
The CP value is the central value in real-time PCR applications. Everything
is related to this single point. But not much effort has been put into
standardizing and optimizing the determination of this parameter that is so
central to quantification. Most software use the so-called ‘threshold cycle
method’ or ‘fit point method’ and measure the CP at a constant fluorescence
level. But there are other possibilities and options to consider. Let us first
think about the background:
• What kind of background fluorescence is evident, a noisy, a constant, a
rising or a decreasing background?
• Does the software show me my real raw-fluorescence-data or are the
data already manipulated, e.g., additional ROX adjustment?
• What about the curve smoothing of the fluorescence data?
• Which kind of fluorescence background correction and/or subtraction
is applied?
Most real-time platforms show pre-adjusted fluorescence data and pre-
adjusted CP. After doing an automatic background correction the CP value
are determined by various methods, e.g., at a constant level of fluorescence.
These constant threshold methods assume that all samples have the same
DNA concentration at the threshold fluorescence. But measuring the level
of background fluorescence can be a challenge. Often real-time PCR
reactions with significant background fluorescence variations occur, caused
by drift-ups and drift-downs over the course of the reaction. Averaging over
a drifting background will give an overestimation of variance and thus
increase the threshold level (Livak, 1997, 2001; Rasmussen, 2001; Wilhelm
et al., 2003). The threshold level can be calculated by fitting the intersecting
line at 10 standard deviations above baseline fluorescence level. This acqui-
sition mode can be easily automated and is very robust (Livak, 1997, 2001).
In the fit point method the user has to discard uninformative background
points, exclude the plateau values by entering the number of log-linear
points, and then fit a log line to the linear portion of the amplification
curves. These log lines are extrapolated back to a common threshold line
and the intersection of the two lines provides the CP value. The strength of
this method is that it is extremely robust. The weakness is that it is not
easily automated and so requires a lot of user interaction, which are more or
less arbitrary (Rasmussen, 2001, LightCycler® Software, 2001).
The real problem lies in comparing numerous biological samples. The
researcher will have problems in defining a constant background for all
samples within one run or between runs. These sample-to-sample differ-
ences in variance and absolute fluorescence values lead to the development
of a new and user-friendly CP acquisition model. As discussed in the previ-
ous section there are several mathematical models to determine the ampli-
fication rate, using a logistic or sigmoidal model. These mathematically fit
models can also be used to determine the optimal CP (Table 3.1). They are
more or less independent of the background level or calculated on the basis
of the background fluorescence and implement the data in the CP determi-
nation model (Tichopad et al., 2004; Wilhelm et al., 2003).
In LightCycler® (Roche Applied Science) and Rotor-Gene™ (Corbett
76 Real-time PCR
Research) software packages these approaches are already implemented. In
second derivative maximum method the CP is automatically identified and
measured at the maximum acceleration of fluorescence (Ramussen, 2001;
LightCycler® Software, 2000). The exact mathematical algorithm applied is
still unpublished, but is very comparable to a logistic fit. In the Rotor-Gene
family using comparative quantification the ‘take of point’ is also calculated
on basis of a sigmoidal model. Both the sigmoidal and polynomial curve
models, work well with high agreement (P<0.001; r>0.99) (Tichopad et al.,
2004; Liu and Saint, 2002a; Liu and Saint, 2002b; Rutledge, 2004). The
sigmoidal exponential function was the more precise and could increase the
exactness and precision of the CP measurement as well as the amplification
efficiency rate (Wilhelm et al., 2003). Peirson further discusses the impor-
tance of threshold setting in relative quantification in Chapter 6.
3.8 Relative quantification data analysis and software
applications
A major challenge is the development of exact and reliable gene expression
analysis and quantification software. A ‘one-fits-all’ detection and applica-
tion software is the target for future developments and seems the optimal
solution. But can we implement various detection chemistries with varying
background and fluorescence acquisition modes in one software package?
Should we not think about optimized models on each real-time platform
and for each applied chemistry? In biological research and in clinical
diagnostics, real-time qRT-PCR is the method of choice for expression profil-
ing. On the one hand cycler and chemistry developed much faster than
detection and analysis software. However, accurate and straightforward
mathematical and statistical analysis of the raw data (cycle threshold/cross-
ing point values or molecules quantified) as well as the management of
growing data sets have become the major hurdles in gene expression analy-
ses. Now the 96-well applications are the standard in the research laborato-
ries, but in the near future high throughput 384-well applications will
generate huge amounts of data. The data need to be grouped (Hellemans et
al., 2006) and standardized by intelligent algorithms. Real-time qPCR data
should be analyzed according to automated statistical method, e.g. Kinetic
Outlier Detection (KOD), to detect samples with dissimilar efficiencies (Bar et
al., 2003). Mostly the statistical data analysis or CP values is performed on
the basis of classical standard parametric tests, such as analysis of variance or
t-tests. Parametric tests depend on assumptions, such as normality of distri-
butions, whose validity is unclear (Sheskin, 2000). In absolute or relative
quantification analysis, where the quantities of interest are derived from
ratios and variances can be high, normal distributions might not be
expected, and it is unclear how a parametric test could best be constructed
(Pfaffl et al., 2002; Sheskin, 2000). At present, the following relative quantifi-
cation data analysis and software applications are available.
3.8.1 LightCycler® Relative Quantification Software
The first commercially available software was the LightCycler® Relative
Quantification Software (2001). It can be used to calculate and compare
Relative quantification 77
relative quantification results of triplicates of a target versus a calibrator
gene. Target genes are corrected via a reference-gene expression and calcu-
lates on the basis of the median of the performed triplets. Real-time PCR
efficiency correction is possible within the software and is calculated from
the calibration curve slope, according to the established eq. 9, ranging from
E = 1.0 (minimum value) to E = 2.0 (theoretical maximum and efficiency
optimum). A given correction factor and a multiplication factor, which are
provided in the product specific applications by Roche Molecular
Biochemicals (LightCycler® Relative Quantification Software, 2001), have to
be incorporated in eq. 6. Importantly, no statistical comparison of the
results by a statistical test is possible.
3.8.2 REST
In 2002, the relative expression software tool (REST, http://rest.gene-
quantification.info) was established as a new tool (Pfaffl et al., 2002). The
first REST version is Excel®-based and programmed in Visual Basic to
compare several gene expressions on CP level. It compares two treatment
groups, with multiple data points in the sample versus control groups, and
calculates the relative expression ratio between them. The mathematical
model used is published and is based on the mean CP deviation between
sample and control group of target genes, normalized by the mean CP devia-
tion of one reference gene as shown in eq. 7 (Pfaffl et al., 2002). Further an
efficiency correction can be performed, either based on the dilution method
(eq. 9) or an optimal efficiency of E = 2.0 is assumed. The big advantage of
REST is the provision of a subsequent statistical test of the analyzed CP
values by a Pair-Wise Fixed Reallocation Randomization Test (Pfaffl et al.,
2002). Permutation or randomization tests are a useful alternative to more
standard parametric tests for analyzing experimental data (Manly, 1997;
Horgan and Rouault, 2000). They have the advantage of making no distrib-
utional assumptions about the data, while remaining as powerful as
conventional tests. Randomization tests are based on one we know to be
true: that treatments were randomly allocated. The randomization test
repeatedly and randomly reallocates at least 2000 times the observed CP
values to the two groups and notes the apparent effect each time, here in
the expression ratio between sample and control treatment. The REST
software package makes full use of the advantages of a randomization test.
In the applied two-sided Pair-Wise Fixed Reallocation Randomization Test for
each sample, the CP values for reference and target genes are jointly reallo-
cated to control and sample groups (= pair-wise fixed reallocation), and the
expression ratios are calculated on the basis of the mean values. In practice,
it is impractical to examine all possible allocations of data to treatment
groups, and a random sample is drawn. If 2000 or more randomizations are
taken, a good estimate of P-value (standard error <0.005 at P = 0.05) is
obtained. Randomization tests with a pair-wise reallocation are seen as the
most appropriate approach for this type of application. In 2005 various new
REST versions were developed, calculating with a geometric mean averaged
REF index (Vandescompele et al., 2002; Pfaffl et al., 2004), according to the
mathematical model described in eq. 8, which can analyze 15 target and
reference genes (REST-384) (LightCycler® Relative Quantification Software,
78 Real-time PCR
2001). Specialized REST versions can compare six treatment group with one
non-treated control (REST-MCS, REST – Multiple Condition Solver)
(LightCycler® Relative Quantification Software, 2001), or take individual
amplification efficiency into account, exported from the Rotor-Gene (REST-
RG). A stand alone application REST-2005 was developed, running indepen-
dent of Excel® or Visual Basic, comparing ‘unlimited’ target and reference
genes, using newly developed bootstrapping statistical tool, and graphical
output showing 95% confidence interval (TUM and Corbett Research,
2005) (Pfaffl and Horgan, 2005).
3.8.3 Q-Gene
Recently a second software tool, Q-Gene, was developed, which is able to
perform a statistical test of the real-time data (Muller et al., 2002). Q-Gene
manages and expedites the planning, performance and evaluation of
quantitative real-time PCR experiments. The expression results were
presented by graphical presentation. An efficiency correction according to
the dilution method is possible (eq. 9). Q-Gene can cope with complex
quantitative real-time PCR experiments at a high-throughput scale (96-well
and 384-well format) and considerably expedites and rationalizes the exper-
imental set-up, data analysis, and data management while ensuring highest
reproducibility. The Q-Gene Statistics Add-In is a collection of several VBA
programs for the rapid and menu-guided performance of frequently used
parametric and non-parametric statistical tests. To assess the level of signif-
icance between any two groups’ expression values, it is possible to perform
a paired or an unpaired Student’s test, a Mann-Whitney U-test, or Wilcoxon
signed-rank test. In addition, the Pearson’s correlation analysis can be
applied between two matched groups of expression values. Furthermore, all
statistical programs calculate the mean values of both groups analyzed and
their difference in percent (Muller et al., 2002).
3.8.4 qBASE
Comparable software application qBASE was recently developed by
colleagues to offer solutions to compare more real-time set-ups (Hellemans
et al., 2006). QBASE is an Excel®-based tool for the management and auto-
matic analysis of real-time quantitative PCR data (http://medgen.ugent.be/
qbase). The qBASE browser allows data storage and annotation while
keeping track of all real-time PCR runs by hierarchically organizing data
into projects, experiments, and runs. It is compatible with the export files
from many currently available PCR instruments and provides easy access to
all the data, both raw and processed. The qBASE analyzer contains an easy
plate editor, performs quality control, converts CP values into normalized
and rescaled quantities with proper error propagation, and displays results
both tabulated and in graphs. One big advantage of the program is that it
does not limit the number of samples, genes and replicates, and allows data
from multiple runs to be combined and processed together (Hellemans et
al., 2006). The possibility of using up to five reference genes allows reliable
and robust normalization of gene expression levels, on the basis of the
geNorm normalization procedure (Vandescompele et al., 2002). qBASE
Relative quantification 79
allows the easy exchange of data between users, and exports tabulated data
for further statistical analyses using dedicated software.
3.8.5 SoFAR
The algorithms implemented in SoFAR (distributed by Metralabs) allow
fully automatic analysis of real-time PCR data obtained with a Roche
LightCycler® (Roche Diagnostics) instrument. The software yields results
with considerably increased precision and accuracy of real-time
quantification. This is achieved mainly by the correction of amplification
independent fluorescence signal trends and a robust fit of the exponential
phase of the signal curves. The melting curve data are corrected for signal
changes not due to the melting process and are smoothed by fitting cubic
splines. Therefore, sensitivity, resolution, and accuracy of melting curve
analyses are improved (Wilhelm et al., 2003).
3.8.6 DART-PCR
DART-PCR (Data Analysis for Real-Time PCR) provides a simple means of
analyzing real-time PCR data from raw fluorescence data (Peirson et al.,
2003) (http://nar.oxfordjournals.org/cgi/content/full/31/14/e73/DC1). This
allows an automatic calculation of amplification kinetics, as well as perform-
ing the subsequent calculations for the relative quantification and calcula-
tion of assay variability. Amplification efficiencies are also tested to detect
anomalous samples within groups (outliers) and differences between experi-
mental groups (amplification equivalence). Data handling was simplified by
automating all calculations in an Excel® worksheet, and enables the rapid
calculation of threshold cycles, amplification rate and resulting starting
values, along with the associated error, from raw data. Differences in ampli-
fication efficiency are assessed using one-way analysis of variance (ANOVA),
based upon the null hypotheses, that amplification rate is comparable
within sample groups (outlier detection) and that amplification efficiency is
comparable between sample groups (amplification equivalence) (Peirson et
al., 2003).
3.9 Conclusion
Facilitating data management and providing tools for automatic data analysis,
these software applications address one of the major problems in doing real-
time quantitative PCR-based nucleic acid quantification. Nevertheless,
successful application of real-time RT-PCR and relative quantification depends
on a clear understanding of the practical problems. Therefore a coherent
experimental design, application, and validation of the individual real-time
RT-PCR assay remains essential for accurate, precise and fully quantitative
measurement of mRNA transcripts. An advantage of most described software
applications (except SoFAR) is that they are freely available and scientists can
use them for their academic research. qBASE intends to be an open source
project and interested parties can write their own analysis or visualization
plug-ins. All calculation- and statistical-software applications are summarized
and described in detail at http://bioinformatics.gene-quantification.info.
80 Real-time PCR
References
Bar T, Stahlberg A, Muszta A, Kubista M (2003) Kinetic Outlier Detection (KOD) in
real-time PCR. Nucleic Acids Res 31(17): e105.
Burkardt HJ (2000) Standardization and quality control of PCR analyses. Clin Chem
Lab Med 38(2): 87–91.
Bustin SA. (2000) Absolute quantification of mRNA using real-time reverse transcrip-
tion polymerase chain reaction assays. J Mol Endocrinol 25: 169–193.
Bustin SA (2002) Quantification of mRNA using real-time RT-PCR. Trends and
problems. J Mol Endocrinol 29(1): 23–39.
Bustin SA (ed) (2004) A–Z of quantitative PCR. La Jolla, CA: IUL Biotechnology Series,
International University Line.
Bustin SA, Benes V, Nolan T, Pfaffl MW (2005) Quantitative real-time RT-PCR – a
perspective. J Mol Endocrinol 34(3): 597–601.
Dirnhofer S, Berger C, Untergasser G, Geley S, Berger P (1995) Human beta-actin
retro pseudogenes interfere with RT-PCR. Trends Genet 11(10): 380–381.
Donald CE, Qureshi F, Burns MJ, Holden MJ, Blasic JR Jr, Woolford AJ (2005) An
inter-platform repeatability study investigating real-time amplification of
plasmid DNA. BMC Biotechnol 5(1): 15.
Ercolani L, Florence B, Denaro M, Alexander M (1988) Isolation and complete
sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase
gene. J Biol Chem 263(30): 15335–15341.
Freeman TC, Lee K, Richardson PJ (1999) Analysis of gene expression in single cells.
Curr Opin Biotechnol 10(6): 579–582.
Fronhoffs S, Totzke G, Stier S, Wernert N, Rothe M, Bruning T, Koch B, Sachinidis A,
Vetter H, Ko Y (2002) A method for the rapid construction of cRNA standard
curves in quantitative real-time reverse transcription polymerase chain reaction.
Mol Cell Probes 16(2): 99–110.
Gibson UE, Heid CA, Williams PM (1996) A novel method for real time quantitative
RT-PCR. Genome Res 6: 1095–1101.
Heid CA, Stevens J, Livak KJ, Williams PM (1996) Real time quantitative PCR. Genome
Res 6: 986–993.
Hellemans J, Mortier G, Coucke P, De Paepe A, Speleman F, Vandesompele J (2006)
qBase: open source relative quantification software for management and
automated analysis of real-time quantitative PCR data (submitted to Biotechniques).
Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis: Real-time
monitoring of DNA amplification reactions. Biotechnology 11(9): 1026–1030.
Horgan GW, Rouault J (2000) Introduction to Randomization Tests. Biomathematics
and Statistics Scotland.
Huggett J, Dheda K, Bustin S, Zumla A (2005) Real-time RT-PCR normalisation;
strategies and considerations. Genes Immun 6(4): 279–284.
Lai KK, Cook L, Krantz EM, Corey L, Jerome KR (2005) Calibration curves for real-
time PCR. Clin Chem 51(7): 1132–1136.
LightCycler Relative Quantification Software (2001) Version 1.0, Roche Molecular
Biochemicals.
LightCycler Software® (2001) Version 3.5; Roche Molecular Biochemicals.
Liu W, Saint DA (2002a) A new quantitative method of real time reverse transcrip-
tion polymerase chain reaction assay based on simulation of polymerase chain
reaction kinetics. Anal Biochem 302(1): 52–59.
Liu W, Saint DA (2002b) Validation of a quantitative method for real time PCR
kinetics. Biochem Biophys Res Commun 294(2): 347–353.
Livak KJ (1997 & 2001) ABI Prism 7700 Sequence detection System User Bulletin #2
Relative quantification of gene expression. ABI company publication.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2ΔΔC(T) Method. Methods 25(4): 402–408.
Relative quantification 81
Lockey C, Otto E, Long Z (1998) Real-time fluorescence detection of a single DNA
molecule. Biotechniques 24: 744–746.
Mackay IM, Arden KE, Nitsche A (2002) Real-time PCR in virology. Nucleic Acids Res
30: 1292–1305.
Manly B (1998) Randomization, Bootstrap and Monte Carlo Methods in Biology. London:
Chapman & Hall.
Meijerink J, Mandigers C, van de Locht L, Tonnissen E, Goodsaid F, Raemaekers J
(2001) A novel method to compensate for different amplification efficiencies
between patient DNA samples in quantitative real-time PCR. J Mol Diagn 3(2):
55–61.
Morse DL, Carroll D, Weberg L, Borgstrom MC, Ranger-Moore J, Gillies RJ (2005)
Determining suitable internal standards for mRNA quantification of increasing
cancer progression in human breast cells by real-time reverse transcriptase
polymerase chain reaction. Anal Biochem 342(1): 69–77.
Muller PY, Janovjak H, Miserez AR, Dobbie Z (2002) Processing of gene expression
data generated by quantitative real-time RT-PCR. Biotechniques 32(6):
1372–1378.
Orlando C, Pinzani P, Pazzagli M (1998) Developments in quantitative PCR. Clin
Chem Lab Med 36(5): 255–269.
Peccoud J, Jacob C (1996) Theoretical uncertainty of measurements using quantita-
tive polymerase chain reaction. Biophys J 71(1): 101–108.
Peirson SN, Butler JN, Foster RG (2003) Experimental validation of novel and
conventional approaches to quantitative real-time PCR data analysis. Nucleic
Acids Res 31(14): e73.
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Res (2001) 29(9): e45.
Pfaffl MW (2004) Quantification strategies in real-time PCR. In: Bustin SA (ed), A–Z
of Quantitative PCR, pp. 87–120. La Jolla, CA: IUL Biotechnology Series,
International University Line.
Pfaffl MW, Georgieva TM, Georgiev IP, Ontsouka E, Hageleit M, Blum JW (2002) Real-
time RT-PCR quantification of insulin-like growth factor (IGF)-1, IGF-1 receptor,
IGF-2, IGF-2 receptor, insulin receptor, growth hormone receptor, IGF-binding
proteins 1, 2 and 3 in the bovine species. Domest Anim Endocrinol 22(2): 91–102.
Pfaffl MW, Hageleit M (2001) Validities of mRNA quantification using recombinant
RNA and recombinant DNA external calibration curves in real-time RT-PCR.
Biotechn Lett 23: 275–282.
Pfaffl MW, Horgan GW (2002) Physiology, (REST©/REST-XL©) Weihenstephan,
Technical University of Munich.
Pfaffl MW, Horgan GW (2005) (REST-2005©) Technical University of Munich and
Corbett Research.
Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST)
for group-wise comparison and statistical analysis of relative expression results
in real-time PCR. Nucleic Acids Res 30(9): e36.
Pfaffl MW, Horgan GW, Vainshtein Y, Avery P (2005) (REST-384©. REST-MCS©, REST-
RG©) Physiology, Weihenstephan, Technical University of Munich.
Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of stable
housekeeping genes, differentially regulated target genes and sample integrity:
BestKeeper – Excel-based tool using pair-wise correlations. Biotechnol Lett 26(6):
509–515.
Ramakers C, Ruijter JM, Deprez RH, Moorman AF (2003) Assumption-free analysis of
quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett
339(1): 62–66.
Rasmussen, R (2001) Quantification on the LightCycler. In: Meuer S, Wittwer C,
Nakagawara K (eds) Rapid cycle real-time PCR, methods and applications. Springer
Press, Heidelberg.
82 Real-time PCR
Rutledge RG (2004) Sigmoidal curve-fitting redefines quantitative real-time PCR with
the prospective of developing automated high-throughput applications. Nucleic
Acids Res 32(22): e178.
Schmittgen TD, Zakrajsek BA (2000) Effect of experimental treatment on housekeep-
ing gene expression: validation by real-time, quantitative RT-PCR. J Biochem
Biophys Methods 46(1–2): 69–81.
Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW (2000)
Quantitative reverse transcription-polymerase chain reaction to study mRNA
decay: comparison of endpoint and real-time methods. Anal Biochem 285(2):
194–204.
Sheskin D (2000) Handbook of Parametric and Nonparametric Statistical Procedures. CRC
Press LLC, Boca Raton, FL.
Skern R, Frost P, Nilsen F (2005) Relative transcript quantification by quantitative
PCR: roughly right or precisely wrong? BMC Mol Biol 6(1): 10.
Soong R, Ruschoff J, Tabiti, K (2000) Detection of colorectal micrometastasis by
quantitative RT-PCR of cytokeratin 20 mRNA. Roche Molecular Biochemicals
internal publication.
Souaze F, Ntodou-Thome A, Tran CY, Rostene W, Forgez P (1996) Quantitative RT-
PCR: limits and accuracy. Biotechniques 21(2): 280–285.
Steuerwald N, Cohen J, Herrera RJ, Brenner CA (1999) Analysis of gene expression in
single oocytes and embryos by real-time rapid cycle fluorescence monitored RT-
PCR. Mol Hum Reprod 5: 1034–1039.
Tichopad A, Didier A, Pfaffl MW (2004) Inhibition of real-time RT-PCR quantifica-
tion due to tissue specific contaminants. Molec Cellular Probes 18: 45–50.
Tichopad A, Dilger M, Schwarz G, Pfaffl MW (2003) Standardised determination of
real-time PCR efficiency from a single reaction setup. Nucl Acids Res 31(20):
e122.
Tichopad A, Dzidic A, Pfaffl MW (2003) Improving quantitative real-time RT-PCR
reproducibility by boosting primer-linked amplification efficiency. Biotechnol
Lett 24: 2053–2056.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F
(2002) Accurate normalization of real-time quantitative RT-PCR data by geo-
metric averaging of multiple internal control genes. Genome Biol 3(7):
0034.1–0034.11
Wilhelm J, Pingoud A, Hahn M (2003) SoFAR – Validation of an algorithm for
automatic quantification of nucleic acid copy numbers by real-time polymerase
chain reaction. Anal Biochem 317(2): 218–225.
Wittwer CT, Garling DJ (1991) Rapid cycle DNA amplification: Time and tempera-
ture optimization. BioTechniques 10: 76–83.
Wittwer CT, Herrmann MG, Gundry CN, Elenitoba-Johnson KS (2001) Real-time
multiplex PCR assays. Methods 25(4): 430–442.
Wong ML, Medrano JF (2005) Real-time PCR for mRNA quantitation. Biotechniques
39(1): 75–85.
Normalization
Jim Huggett, Keertan Dheda and Stephen A Bustin 4
4.1 Introduction
The specificity, wide dynamic range and ease-of-use of the real-time
quantitative reverse transcription polymerase chain reaction (qRT-PCR) has
made it the method of choice for quantitating RNA levels. However, as with
any scientific measurement, qRT-PCR suffers from problems caused by error
(Huggett et al., 2005). Consequently, data normalization is an indispensable
component of the qRT-PCR analysis process, and is essential for accurate
comparison of qRT-PCR measurements between different samples.
Normalization controls for variation in the total mass of RNA analyzed and,
ideally, corrects for any biological and technical variability. Both of these
pose serious problems for gene expression analyses and manifest themselves
as noise that can either mask or overstate true expression levels and
patterns. It is vexing that whilst the requirement to incorporate some
normalization method to control for error is obvious, in practice it remains
one of the most discussed, but unsolved problems of qRT-PCR analysis
(Huggett et al., 2005). This chapter will outline normalization, address the
associated problems when using real-time PCR and discuss data interpreta-
tion once normalization has been performed.
4.2 General error and directional shift
There are two types of error that must be controlled for in a qRT-PCR assay.
One is general error (noise) and directional shift: Figure 4.1 shows the many
stages at which general error can be introduced into a qRT-PCR assay.
Directional shift occurs when poor normalization either creates an arti-
factual difference or obscures a real difference between experimental
夽 1
Sample Extraction
夽2
RNA
Reverse
夽3
cDNA Real-time
夽 4
Result
transcription PCR
Figure 4.1
Multistage process required to obtain a real-time RT-PCR result. Stars indicate
the points at which normalization can be performed: 1: sampling, 2: RNA, 3:
cDNA and 4: PCR dependent standard.
84 Real-time PCR
Norm. floro.
10A-1
10A-2
Threshold
10A-3
0 5 10 15 20 25 30
Figure 4.2
Example of a triplicate real-time PCR reaction (using the same template). This
demonstrates that real-time PCR can be highly reproducible with coefficients of
variation of <5%).
groups. Real-time PCR has been reported to measure two-fold differences in
nucleic acid amounts (Bubner et al., 2004) and is certainly capable of coeffi-
cient of variation (CV) of <1 % (Figure 4.2). However, achieving consistently
low CVs in qRT-PCR assays is not as simple, with even the best CVs signifi-
cantly higher than 1% (Melo et al., 2004). The main reason for this is that it
is not feasible to determine directly the target RNA. Instead, RNA quantifi-
cation requires the inclusion of several steps that eventually measure cDNA
copy numbers, but that also serve as sources of systematic variation, increas-
ing CV and limiting the resolution of the assay. Variability is introduced
during sampling, RNA extraction, cDNA synthesis and comparison with
PCR dependent controls, and appropriate normalization of each step is
essential (Figure 4.1).
4.3 Methods of normalization
4.3.1 Sample size
The most basic method of normalization ensures that an experiment
compares similar sample sizes and this is achieved by measuring tissue
weight, volume or cell number. If no attempt to use similar sample sizes is
made, unnecessary error may be introduced at the first stage of the assay.
Furthermore, different extraction protocols may add to variability,
especially as the extraction of RNA from differing amounts of tissue is
usually subject to differing efficiencies. This is a particular problem when
the extraction method becomes saturated and results in inefficient extrac-
tion of RNA from large samples. Unfortunately sample sizing is often not as
simple as might be assumed. The examples below demonstrate that use of a
similar sample size may still mean extracting RNA from highly dissimilar
samples.
Figure 4.3
Colorectal cancer biopsy. Just over one third of the section is made up of
tumour, the rest is adjacent normal colon. At least three cell types (epithelial,
stromal and T cells) are clearly distinguishable.
Figure 4.4
Laser microdissected colorectal crypt. The crypt highlighted by an arrow in the first picture has
been ablated in the second picture. The software measures the dimensions of the dissected sample
and displays its area in μm2.
Proliferating chondrocytes
Nonproliferating hypertrophic chondrocytes
Figure 4.5
Longitudinal section of an epiphysis growth plate. Sample sizing comparisons
between the larger nonproliferating cells with the proliferating cells are
extremely difficult with this tissue. Any result must also consider the difference
in the size of the active small cells and the less active larger cells.
Normalization 85
1. Sampling blood from HIV patients (Huggett et al., 2005) allows their
stratification into groups based on their CD4+ T-cell numbers. Patients
with >200 cells/ml may be otherwise healthy whereas those with counts
of <200/ml are considered to have acquired immune deficiency
syndrome (AIDS). Clearly, since AIDS patients have fewer CD4+ cells
per volume of blood, normalizing cell mRNA copy numbers against
blood volume alone would result in inaccurate and biologically
meaningless quantification.
2. In vivo biopsies contain numerous cell types from different lineages and
may contain different types of tissue, e.g. adjacent normal and cancer
(Figure 4.3, color plate, between pages 38 and 39). This is resulting in a
more widespread use of laser microdisssection and makes it feasible to
normalize against the dissected area, allowing the reporting of copy
numbers per area excised (Figure 4.4, color plate, between pages 38 and
39). Of course, one has to assume that the extraction efficiency and
integrity of the RNAs extracted from different areas are similar, which
may not be the case. It is acceptable to do this when comparing expres-
sion patterns from the same slide, as the tissue will have been subject to
identical treatment. It is probably also acceptable to use this method for
normalization when comparing different sections from the same tissue
block. It remains to be seen whether it is acceptable to use this method
for comparison between samples obtained from different tissue blocks.
3. Another problem when using similar sample sizes may occur when
comparing samples that differ histologically. In situations where fibro-
sis has occurred or if young tissue is being compared with older tissue
the efficiency by which nucleic acid is extracted from the sample may
be very different. If different nucleic acids amounts are extracted from
the same amount of histologically different samples then this will lead
to a directional shift and any measurement will be influenced by the
decrease in extraction efficiency from one of the groups. Another
problem relates to samples containing cell types that differ significantly
in their respective sizes; again, this can interfere with accurate quantifi-
cation (Figure 4.5, color plate, between pages 38 and 39).
4. Many of the problems associated with in vivo samples might be
expected to be overcome in in vitro systems. However, culture can
provide its own problems when sampling (Figure 4.6). Non-adherent
cells that do not aggregate represent the ideal starting material however
this scenario is the exception rather than the norm. Furthermore the
cells may become phenotypically very different as a result of the
variable being tested by the experiment. Cells can be treated with
buffers and/or enzymes to cause them to detach or segregate facilitating
counting, however these treatments are almost certainly going to effect
gene expression.
Cleary, whilst it is essential to compare samples of similar size and compo-
sition, ensuring that this is actually the case is often more complicated than
it may at first appear. Consequently, we stress the importance of careful
consideration of sample selection and emphasize that additional methods
of normalization must be used.
86 Real-time PCR
Figure 4.6
Normalization against cell number. It may be impossible to normalize against
total cell number even when using tissue culture cells, as demonstrated by this
neuronal cell line.
4.3.2 Total RNA amount
Once the RNA has been extracted, the next stage of normalization can be
performed by ensuring that the same amount is used for each reverse
transcription reaction. Not only does this facilitate normalization but
circumvents problems associated with the linearity of the reverse transcrip-
tase step. However, normalizing against total RNA requires accurate
measurement of RNA quantity and again this is not straightforward. A
number of different methods are available; most commonly, optical
methods using spectrophotometry or fluorimetry with fluorescent dyes
(Ribogreen) are used and provide varying degrees of accuracy. What is also
important, but often overlooked, is the need to assess the quality of RNA
because degraded RNAs may adversely affect results (Bustin and Nolan,
2004). Most commonly, gel electrophoresis or analysis using the Agilent
Bioanalyser/Biorad Experion is used to determine the integrity of the
ribosomal RNA (rRNA) band.
Normalization 87
There are several drawbacks to normalization against total RNA: it is not
easy to take into consideration differences in mRNA integrity, it does not
allow for differences caused by the presence of inhibitors and ignores the
efficiency of converting RNA into cDNA. Even if RNA integrity is assessed,
any quality statement refers to rRNA, not mRNA. Total RNA comprises
~80% rRNA (with the protein coding mRNA comprising ~2–5% depending
cell type); consequently, degradation of rRNA may not directly reflect
degradation of mRNA. In addition, the relative amounts of rRNA and mRNA
often differ between samples, especially when the mRNA originates from
highly proliferating tissue, e.g., cancers. Of course, it is possible to extract
mRNA, but this involves additional steps thereby potentially increasing
experimental error, which can significantly reduce yield and may result in
long-term stability problems. Furthermore, mRNA extraction is currently
limited to the extraction of poly-adenylated mRNAs so will not purify non-
adenylated mRNAs, for example those specifying histones.
4.3.3 Quantification of cDNA
Following the reverse transcription a method for measuring the amount of
cDNA that has been reverse transcribed would be desirable; the only reliable
method to do this is to quantify the synthesis of radio labeled cDNA. This
strategy was more commonly used 10 years ago but the requirement for
using radio isotopes coupled with the extensive increase in the use of qRT-
PCR has resulted in this method rarely being used today.
Alternative methods have been proposed using spectrophotometry or
DNA specific binding dyes but the major problem is that there is usually
much more RNA than cDNA present after a reverse transcription. However,
these are not satisfactory, as the background noise levels generate
additional errors that tend to mask our ability to quantitate accurately the
amount of synthesized cDNA. However, new methods for more accurate,
non-radioactive quantification of cDNA synthesis efficiency are being
developed and it is likely that normalization against cDNA will become
feasible in the not too distant future.
4.3.4 PCR dependent reference
The use of a PCR dependent reference is by far the most attractive nor-
malization option. In theory it is also the most straightforward method, as
both the target gene and PCR dependent reference are measured by real-
time PCR and all that is required for their measurement are additional PCR
reactions. There are four types of PCR dependent references available:
Genomic DNA
Genomic DNA (gDNA) measures the amount of gDNA co-extracted with the
RNA. This method does not require reverse transcription and so does not
control for error introduced by this method. However, the problem with
measuring gDNA is that most RNA extraction techniques try and eliminate
co-extracted DNA as much as possible since DNA can inhibit the RT-PCR
assay. Nevertheless, gDNA PCR dependent referencing has played an
88 Real-time PCR
important role in research into early stage embryonic development as it can
provide very accurate information about which division stage is being
measured (Hartshorn et al., 2003).
Spike
Spiking the sample with a distinctive (alien) nucleic acid allows an assess-
ment of extraction efficiency and can be used for normalization. The spike,
as long as it is not found in the sample of interest, can be synthetic or from
another organism. This method benefits from the fact that accurately
defined amounts of the spike can be introduced prior to extraction allowing
good estimation of error introduced through most of the stages of process-
ing. If RNA spikes are used the reverse transcription reaction can also be
controlled for which is essential for fine measurements. The main criticism
of using spikes is that, while they can be introduced prior to extraction,
unlike the cellular RNAs they are not extracted from within the tissue.
Consequently, there may be situations (e.g. if the samples differ histologi-
cally) when the spike may not be a good control for the extraction proce-
dure. The concept of the RNA spike has been taken to its maximum level
with RNA viral titer measurements from human plasma; here similar whole
viruses (e.g., brome mosaic virus when measuring HIV) can be used as spikes
providing detailed information on extraction efficiency, reverse transcrip-
tase efficiency, can be used to control for PCR inhibition and defining the
dynamic range linear limit of the multistaged process outlined in Figure 1.
Reference genes
Reference genes represent the by far most common method for normalizing
qRT-PCR data. This strategy targets RNAs that are, it is hoped/assumed/
demonstrated, universally and constitutively expressed, and whose expres-
sion does not differ between the experimental and control groups, to report
any variation that occurs due to experimental error. Theoretically, reference
genes are ideal as they are subject to all the variation that affects the gene of
interest. The problem occurs when a reference gene is used without valida-
tion.
Reference genes (previously termed housekeeping genes) such as GAPDH
(glyceraldehyde-3-phosphate dehydrogenase) are historical carry-overs
from RNA measurement techniques that generate more qualitative results
(northern blotting, RNase protection assay). These genes were found to be
essential for cell metabolism and, importantly, always switched on. Since
northern blot analysis is mainly concerned with gross up-or-down regula-
tion, they were perfectly adequate as loading controls.
The development of qRT-PCR transformed RNA analysis from a qualita-
tive and, at best semi-quantitative assay, to a quantitative high-throughput
one. Suddenly it became possible to measure far more than crude alter-
ations in RNA expression; it was possible to detect reproducibly small
changes in mRNA levels and provide numerical values that could be subject
to statistical analysis.
The increasing emphasis on quantification meant that the requirement
for ubiquitous expression was no longer sufficient. Now its expression also
Normalization 89
had to be stable and not be affected by experimental design. At best a poorly
chosen reference gene would reduce the resolution of the assay by intro-
ducing additional noise and, at worst, the reference gene would be directly
affected by the experimental system; directional shift would either hide a
true change in the gene of interest or present a completely false result.
What has become apparent over recent years is that there is no single
reference gene for all experimental systems (at least none has been discov-
ered). Vandesompele et al., (2002) quantified errors related to the use of a
single reference gene as more than three-fold in 25% and more than six-fold
in 10% of samples. Tricarico et al., (2002) showed that VEGF mRNA levels
could be made to appear increased, decreased, or unchanged between
paired normal and cancer samples, depending only on the normaliser
chosen. Today it is clear that reference genes must be carefully validated for
each experimental situation and that new experimental conditions or
different tissue samples require re-validation of the chosen reference genes
(Schmittgen, 2000). There are two strategies that can be used to validate a
reference gene:
(a) the first method is the whole error approach; this strategy directly
measures the error of the raw data of candidate reference genes within
the experimental system as illustrated by Dheda et al. (2004). The
measured error comprises both the experimental error and the bio-
logical fluctuation of the chosen reference gene. This method is depen-
dent on good laboratory technique not introducing technical error that
will reduce the resolution, may require one of the other normalization
methods discussed above to increase this resolution, and is dependent
on choosing the correct reference. This approach scores over strategies
that normalize against total RNA in that it defines the resolution of the
individual assay and so provides a measurable parameter for assessing
the likelihood of a quantitative result being meaningful. This method
provides a simple strategy for reference gene normalization and is ideal
when resources are limiting and when the measurement of larger differ-
ences (>five-fold) are required. However, this strategy is inappropriate
when measuring more subtle changes in mRNA levels (<two-fold). This
is due to the fact that the initial validation must be normalized to
another factor (e.g. total RNA) and so is limited by the resolution of this
factor, which may not be accurately measurable.
(b) The second method uses the error induced trends approach. This strat-
egy also measures the error of the raw data of candidate reference genes
within the experimental system. However this strategy differs from the
single validated reference gene approach by comparing the fluctuations
between the respective reference genes. Consequently, should error be
introduced by a particular sample that artificially increases the measure-
ment this will be observed within all the measured reference genes and
can be compensated. Furthermore, by measuring the geometric mean as
opposed to the arithmetic mean the influence of outliers can be greatly
reduced (Vandesompele et al., 2002). As with the single validated gene
approach, this method defines the assay resolution; however it can give
a far better estimation of this resolution as it is independent of technical
error so that measurements as small as 0.5 fold have been reported
90 Real-time PCR
(Depreter et al., 2002). The drawback to this method is that it requires
the measurement of at least three reference genes and, for very fine
resolution, may require as many as 10. This is hardly feasible when
comparing expression patterns in numerous tissues, or when using
several different treatment regimes. Furthermore, it may be necessary to
revalidate reference genes when changing extraction procedures, using
new enzymes or analysis procedures.
The two strategies constitute two extremes: one is applicable when measur-
ing relatively large changes on a small budget (whole error approach), the
other when the emphasis is more on measuring subtle changes in mRNA
levels (error induced trends approach).
When choosing potential candidate reference genes the resolution can be
increased if candidate genes are chosen based on their function not being
involved in the experimental question. For example, there is no point in
using GAPDH as a reference gene when analyzing glycolytic pathways as
GAPDH is directly involved in this and so would be likely to be influenced
by studies that looked at sugar metabolism, for example.
Data can also be supported by measuring a number of different reference
genes which can strengthen conclusions as the experiment can be validated
using the error induced trends approach on an individual experimental
basis; this is of particular value when small measurements need to be made.
Finally, it is important that intergroup comparisons must take into account
any variability of the reference genes, as this defines the overall error and
provides an estimate of the reliability of measurements of mRNA levels.
4.4 Conclusion
qRT-PCR has revolutionized RNA expression measurement that led to an
explosion of publications over the last 8 years. Ironically, acceptable
normalization methods, particularly with reference genes, have remained a
contentious issue and it has only been over the last 4 years that this has
been addressed. Despite this, even today RNA expression data are published
with no mention of whether the methods used for normalization have been
validated. However, without this validation the assay may not have the
resolution to detect small changes or worse produce artefactual results.
Worryingly, papers are still being published even though the authors have
not demonstrated any validation of their normalization strategies.
References
Bubner B, Gase K, Baldwin IT (2004). ‘Two-fold differences are the detection limit for
determining transgene copy numbers in plants by real-time PCR.’ BMC
Biotechnol 4(1): 14.
Bustin SA, Nolan T (2004). Pitfalls of quantitative real-time reverse-transcription
polymerase chain reaction. J Biomol Tech 15(3): 155–166.
Depreter M, Vandesompele J, Espeel M, Speleman F (2002) Modulation of the per-
oxisomal gene expression pattern by dehydroepiandrosterone and vitamin D:
therapeutic implications. J Endocrinol 175: 779–792.
Dheda KJ, Huggett F, Bustin SA, Johnson MA, Rook G, Zumla A (2004) Validation of
Normalization 91
housekeeping genes for normalizing RNA expression in real-time PCR.
Biotechniques 37(1): 112–114, 116, 118–119.
Hartshorn C, Rice JE, Wangh LJ (2003) Differential pattern of Xist RNA accumulation
in single blastomeres isolated from 8-cell stage mouse embryos following laser
zona drilling. Mol Reprod Dev 64(1): 41–51.
Huggett J, Dheda K, Bustin S, Zumla A (2005) Real-time RT-PCR normalization;
strategies and considerations. Genes Immun 6(4): 279–284.
Melo MR, Faria CDC, Melo KC, Reboucas NA, Longui CA (2004) Real-time PCR
quantitation of glucocorticoid receptor alpha isoform. BMC Molecular Biology 5:
19.
Schmittgen TD, Zakrajsek BA (2000) Effect of experimental treatment on housekeep-
ing gene expression: validation by real-time, quantitative RT-PCR. J Biochem
Biophys Methods 46(1–2): 69–81.
Tricarico C, Pinzani P, Bianchi S, Paglierani M, Distante V, Pazzagli M, Bustin SA,
Orlando C (2002). Quantitative real-time reverse transcription polymerase
chain reaction: normalization to rRNA or single housekeeping genes is inappro-
priate for human tissue biopsies. Anal Biochem 309(2): 293–300.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F
(2002). Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. Genome Biol 3(7):
1–0034.11.
High-throughput primer
and probe design
Xiaowei Wang and Brian Seed
5
The design of appropriate primers for the specific quantitative generation of
DNA amplicons from diverse transcripts is an important requirement for
most applications of real-time PCR. For the simultaneous measurement of
multiple transcripts in a single experiment, an additional constraint, that
all reactions proceed efficiently under the same conditions, must be
imposed. In the first section of this chapter, we describe general primer and
probe design guidelines for real-time PCR. In the second part, we present an
online real-time PCR primer database encompassing most human and
mouse genes identified to date. The primer database contains primers that
perform well under a single set of conditions, allowing many simultaneous
determinations of mRNA abundance to be carried out.
5.1 Primer and probe design guidelines
5.1.1 Primer specificity
Non-specific amplification is one of the greatest challenges for the success-
ful deployment of real-time PCR methods intended to be used for the
validation or discovery of transcript abundance variation. In addition to the
sequence of interest, many thousands of other sequences can be expected to
be present in such applications. The design of PCR primers for this purpose
should therefore take into account the potential contribution of all possible
off-target template sequences, in order to prevent mispriming. This is
usually achieved by comparing sequence similarity between the primers
and all other template sequences in the design space.
5.1.2 Primer length
PCR primers are typically 16–28 nucleotides long. If the length is too short,
it is difficult to design gene-specific primers and choose optimal annealing
temperature. On the other hand, very long oligos unnecessarily increase
oligo synthesis cost. In addition, longer primers are more likely to form
secondary structures that result in decreased PCR efficiency or promote
primer dimer formation, since the primers constitute the nucleic acid
sequences at highest concentration in the reaction.
5.1.3 Primer GC content
In most PCR applications the primer GC content lies between 35% and
65%. If the GC content is too high, mispriming frequently results, because
94 Real-time PCR
even a short stretch of oligo sequence may form a stably annealed duplex
with non-target templates. On the other hand, very low GC content may
result in poor primer binding, leading to decreased PCR efficiency.
5.1.4 Primer 3’ end stability
The 3’ end residues contribute strongly to non-specific primer extension by
Taq DNA polymerase, especially if the binding of these residues is relatively
tight to the non-target template. Therefore, primers with very high 3’ termi-
nal stability should be rejected. The binding stability can be calculated from
the free energy profile (ΔG). Typically the more computationally demand-
ing aspects of calculating free energy, such as loop entropy, can be ignored
because of the unfavorable energetics of opening small loops (internal
denaturation) compared to end melting.
5.1.5 Primer sequence complexity
Low-complexity sequences should be identified and discarded during
primer design, due to the likelihood of mispriming with such primers. In
addition, some types of low sequence complexity pose a challenge for
oligonucleotide synthesis. For example, a large number of contiguous
guanosine residues in a primer can lead to poor synthesis yield due to
decreased chemical coupling efficiency. In addition the resulting primers
can exhibit poor solubility in aqueous media.
5.1.6 Primer melting temperature
The melting temperature (Tm) is the most important factor in determining
the optimal PCR annealing temperature. An ideal PCR reaction should have
forward and reverse primers with similar Tm values. Tm is not only deter-
mined by primer sequence, but also by other parameters, such as salt concen-
tration and primer concentration. In recent years, extensive thermodynamic
studies have been carried out to accurately determine oligo Tm values.
Currently, the following methods for Tm calculation are adopted by most
primer design programs.
The ‘4 + 2’ rule
Tm = 4 * (G + C) + 2 * (A + T ).
This is a simple equation solely based on primer GC content. Tm is calcu-
lated by counting the total number of G/C and A/T. Each G/C contributes
4ºC and each A/T contributes 2ºC to Tm. This method is sometimes used to
quickly approximate Tm values for very short oligos (<10 residues).
However PCR primers are usually much longer and this Tm calculation
method is not generally recommended.
Simple equation based on GC content and salt concentration
Tm = 81.5 + 16.6 * Log10[Na+eq] + 0.41 * (%GC) – 600/L
High-throughput primer and probe design 95
where [Na+eq] is the equivalent sodium molar concentration, (%GC) is the
percent of G/C in the primer, and L is the primer length (Sambrook et al.,
1989). This method is widely used in many computer programs, partially
because it is relatively easy to implement. Despite its simplicity, Tm values
calculated in this way usually have reasonable accuracy and are only a few
degrees different from empirically determined Tm values. In addition, this
method is considered to be the most accurate way to calculate Tm for very
long DNA duplex, such as PCR amplicon.
The nearest neighbor method
Tm = ΔH°/(ΔS° − R ln (CT/4))
where R is the gas constant (1.987 cal/Kmol), CT is the primer concentra-
tion, ΔH° is the enthalpy change, and ΔS° is the entropy change (Breslauer
et al., 1986). This is considered to be the most accurate method to calculate
oligo thermodynamic stability, and thus is the recommended method for
primer Tm determination. ΔH° and ΔS° are calculated using the empirically
determined thermodynamic parameters for neighboring bases in a primer
(SantaLucia, Jr., 1998).
The entropy change is significantly affected by salt concentration. Thus,
an entropy correction is required: ΔS° = ΔS° (1 M Na+) + 0.368 (L – 1)
ln[Na+eq], where L is the primer length and [Na+eq] is the equivalent sodium
molar concentration from all salts in a PCR reaction. According to a recent
study (von Ahsen et al., 2001), [Na+eq] can be determined by the following
equation:
[Na+eq] = [Monovalent cations] + 120 冪[Mg2+] – [dNTPs],
where monovalent cations are typically present as Na+, K+ and Tris+ in PCR
buffer.
5.1.7 Primer location in the sequence
Oligo dT and random primers are commonly used in reverse transcription
(RT) to produce cDNA template for real-time PCR. Oligo dT primers anneal
specifically to mRNA poly(A) tails, thus minimizing non-coding cDNA
products. However, this priming strategy introduces 3’ bias in cDNA synthe-
sis because it is difficult to produce full-length cDNAs due to limited RT
extension capability. If oligo dT primers are used in RT, the real-time PCR
primers should be picked from the 3’ region of a gene sequence to gain
maximum assay sensitivity.
In contrast, random primers are often used in RT for full transcript cover-
age. Random primers can potentially bind to any site in a transcript
sequence. Because all primers are extended toward the 5’ end of the
transcript, there will be a linear gradient of sequence representation, with
highest cDNA abundance in the 5’ regions. If random priming strategy is
adopted, real-time PCR primers should be picked close to the 5’ end of the
target sequence for maximum sensitivity in real-time PCR.
96 Real-time PCR
5.1.8 Amplicon size
PCR efficiency can be affected by amplicon size. Very long amplicons leads
to decreased PCR efficiency. Since PCR efficiency is one of the most impor-
tant factors for accurate expression quantification, the amplicon should be
smaller than 250 bp. Typically the size range is 100–250 bp.
5.1.9 Cross-exon boundary
To minimize the effect of DNA contamination in RNA template, the
forward and reverse primers can be designed from different exons and to
span exon–intron boundaries. In this way one can reduce the genomic DNA
contribution to expression quantitation. This design strategy is most impor-
tant for accurate quantitation of low-expressing genes or genes with many
loci in the genome. However, in general, DNA contamination has minimal
effect on real-time PCR because a typical transcript copy number is much
higher than the number of gene loci and standard RNA preparation proce-
dures remove genomic DNA efficiently. In any case, this strategy may fail if
pseudogenes of the target gene are present in the genome.
5.1.10 Primer and template sequence secondary structures
Primer or target template secondary structures can retard primer annealing,
leading to decreased amplification efficiency. The likelihood of secondary
structure is greatest in regions rich in complementary base pairing, such as
the stem of a stem-loop structure (Mount, 2001). If part of a primer or target
sequence is inaccessible due to secondary-structure formation, the primer
annealing efficiency may decrease dramatically.
In addition, primer secondary-structure may lead to primer dimer forma-
tion, which is one of the biggest challenges for accurate quantification by
real-time PCR, especially when DNA intercalating dyes (e.g., SYBR® Green I)
are used. Primer dimers can be produced by primer self-annealing, or by
annealing between the forward and reverse primers. Therefore, the forward
and reverse primers should be evaluated together during design to avoid
potential primer dimer formation.
5.1.11 TaqMan® probe design
Many of the guidelines for primer design are also applicable to TaqMan®
probe design. It is recommended to use Primer Express® software (Applied
Biosystems) for TaqMan® assay design.
• The probe melting temperature in general should be ~10ºC higher than
the forward or reverse primer.
• Do not put G at the 5’ end of the probe as this will quench reporter
fluorescence.
• In general the GC content should be 35–65%.
• The probe should not self-anneal to form secondary structure and
should not be picked from a gene region with high likelihood of
secondary structure. Secondary structure formation may reduce
hybridization efficiency, leading to reduced assay sensitivity.
High-throughput primer and probe design 97
• The probe should be selected from gene-specific regions with reason-
able sequence complexity to avoid cross-hybridization.
• The probe should be as close to the forward and reverse primers as
possible, without overlapping the primer sequences. The amplicon size
is usually in the range of 60–150.
5.1.12 Molecular beacon probe design
Molecular beacon probes form stem-loop hairpin structures at low temper-
ature. In this closed state, the fluorophore and the quencher are held in
close vicinity, and thus no fluorescence signals are detected (Tyagi and
Kramer, 1996). The hairpin loop contains gene specific sequence for
hybridization in real-time PCR. Thus, the rules for TaqMan® probe design
also apply to molecular beacon loop design. The hairpin structure is
disrupted by hybridization to the amplicon, which separates the
fluorophore from the quencher for fluorescence detection. Because of this
unique structural requirement, one major task for molecular beacon probe
design is to identify a suitable hairpin structure that melts 7–10ºC higher
than the PCR primers. The Tm of the hairpin stem cannot be calculated
using the Tm formulas for PCR primers because the stem is formed by
intramolecular folding. In general, programs for secondary structure predic-
tion, such as Mfold (Zuker, 2003), can be used to predict hairpin stem
melting temperature. The stem usually consists of 5–7 base pairs with
75–100% GC content. A G residue should not be placed at the end of the
stem because it will quench the fluorophore.
5.2 PrimerBank – an online real-time PCR primer database
5.2.1 Primer design algorithm
We have developed a real-time PCR primer design algorithm based on the
general guidelines described in Section 1 (Wang and Seed, 2003a). An
outline of the algorithm is presented in Figure 5.1. The algorithm is
implemented by a design tool called uPrimer, with which we have designed
more than 300,000 primers encompassing most human and mouse genes.
The following comprise detailed descriptions of the properties of these
primers.
Primer specificity
Although primer specificity is one of the most important requirements in
real-time PCR, most primer design programs take only one target sequence
without considering mispriming to off-target templates. At the present
time, to address the mispriming problem, one can design a number of
primer pairs and then individually check cross-matches of each primer with
BLAST (Altschul et al., 1990). However this screening step is incomplete and
does not consider some important design criteria. For example, cross-
matches at the 3’ end of a primer are more likely to produce non-specific
amplicons. In our experience, only about two thirds of the primers designed
in the conventional way can be used in real-time PCR experiments.
98 Real-time PCR
Yes
Iterate
Select a
through End of
new
each Sequence?
primer
sequence
No
Yes Low complexity?
No
Yes Tm out of range?
No
Yes GC% out of range?
No
Yes End stability High?
No
Yes Primer self-complementarity?
No
Yes Contiguous 15-mer match?
No
Yes BLAST score high?
No
Yes Primer-sequence complementarity?
No
Yes Primer dimer?
Figure 5.1 No
A simplified flowchart describing the
primer design algorithm (from Record
Nucleic Acids Research 31(24): e154 primer pair
with permission).
High-throughput primer and probe design 99
Mismatches are known to significantly affect binding stability, and
sometimes even a single mismatch may destabilize a DNA duplex. Therefore
contiguous base pairing is expected to be one of the most important
contributing factors for duplex stability. Our primary filter for primer cross-
reactivity is to reject a stretch of contiguous residues that is also found in
off-target sequences. Every possible 15-mer in a primer sequence is
compared to all known gene sequences in a genome. Primers with repetitive
15-mers are quickly identified and rejected using a computational hashing
technique (Wang and Seed, 2003b). To further reduce cross-reactivity,
BLAST searches for primer sequence similarity are carried out and all quali-
fied primers have BLAST scores of less than 30.
The primer 3’ end is essential to prevent non-specific amplification
because Taq polymerase extension can be greatly retarded by terminal
mismatches (Huang et al., 1992). Therefore a more stringent filter is applied
to cross-matches at the 3’ ends. In our algorithm the cross-hybridizing Tm
for the 3’ end perfect match does not exceed 46 degrees.
Random priming in RT reactions leads to significant amount of non-
coding cDNA products, which are a potential source for mispriming.
Because of their abundance, more stringent primer specificity filters are
applied against non-coding RNA sequences.
Primer and template sequence secondary structures
Secondary structure is most likely to form by Watson–Crick base-pairing. To
reduce self-complementarity, a primer is rejected if it has five contiguous
base-pairs with the primer complementary sequence. To prevent primer
dimer formation, the 4 residues at the 3’ end of a primer should not pair
with its complementary sequence. Similarly, complementarity between the
forward and reverse primers in a primer pair is also evaluated to prevent
detrimental inter-primer dimer formation.
To avoid selecting primers from a template sequence region with potential
secondary structure, a primer is rejected if it has 9 or more contiguous base-
pairs with the target complementary strand. As one additional check, BLAST
similarity search is also carried out to compare the primer and the comple-
mentary sequence of the target and the score is required to be less than 18.
Primer melting temperature
Similar Tm values are one important requirement for uniform PCR
reactions. Primer Tm is calculated using the nearest neighbor method with
the latest thermodynamic parameters. The formula for Tm calculation is
described in details in Section 5.1.6. 250 nM primer and 0.15 M Naeq+
concentrations are used as the default parameters. The default primer and
salt concentrations are commonly used in real-time PCR. Variations in
other typical real-time PCR setups do not significantly affect the Tm values.
Other primer properties
The forward and reverse primers should have similar biochemical properties
to ensure a balanced PCR reaction. If several PCR reactions are carried out
100 Real-time PCR
Figure 5.2
A screenshot of the web interface for PrimerBank. There are several ways to
search for primers: GenBank Accession, NCBI protein accession, Gene ID,
PrimerBank ID or Keyword. PrimerBank currently contains over 300,000 primers
designed for most known human and mouse genes.
simultaneously, it is important that all primers in the reactions be similar.
To provide flexibility in PCR setup, all of our in silico designed primers have
similar properties.
• The primer length is 18–24 residues
• The primer GC content is 35%–65%.
• 3’ end stability. The ΔG value for the five 3’ end bases is at least 9
kcal/mol.
• The PCR product length is 100–250 bp. Occasionally if this requirement
cannot be satisfied, alternative length ranges are used.
• No primer is designed from low-complexity regions. The low-complexity
regions are identified and excluded from primer design by the NCBI
DUST program (Hancock and Armstrong, 1994).
• A primer does not contain 6 or more contiguous same nucleotides.
• A primer does not contain any ambiguous nucleotide.
5.2.2 PrimerBank
To provide easy access to our computationally designed primers, we have
constructed an online primer database, PrimerBank with a freely accessible
web interface (http://pga.mgh.harvard.edu/primerbank). Figure 5.2 is a
screen shot of the primer search page. There are several ways to search for
primers: GenBank Accession, NCBI protein accession, gene ID, PrimerBank
ID or Keyword. PrimerBank currently contains over 300,000 primers
High-throughput primer and probe design 101
designed for most known human and mouse genes. This web site also
presents a detailed experimental protocol for SYBR® Green real-time PCR
and common issues concerning real-time PCR. A short version of the
protocol is given later in this chapter.
5.2.3 Experimental validation of the primer design
We have tested our in silico designed primers for over 1,000 mouse genes.
These genes are known to be expressed in mouse livers by EST library analy-
sis. Therefore we have used mouse liver total RNA in the validation experi-
ments. Real-time PCR melting curve analysis and gel electrophoresis are
performed to evaluate real-time PCR success. In most cases, we observe a
single peak in the melting curve and a single band on gel for one PCR
reaction. Occasionally, the gel and melting curve analyses do not agree with
each other. In these cases, we have also performed DNA sequencing to make
sure there is only a single PCR product. The design success rate, defined as a
single PCR product with reasonable amplification efficiency, was 99% using
these validation methods in an initial screen. A somewhat lower rate
(approximately 93%) has been observed for a primer collection spanning
nearly all of the mouse genome (A. Spandidos, personal communication).
Figure 5.3 shows a validation experiment for 16 cytochrome P-450 genes.
Cytochrome P-450 is a large gene family with ~90% sequence similarity
between some family members. Despite this very high sequence homology,
all 16 P-450 primer pairs lead to single PCR products, validated by both gel
electrophoresis and DNA sequencing. The melting curve analyses also
indicate single PCR products for most of the PCRs (6 examples shown in
Figure 5.3(B)).
5.3 Experimental protocol using PrimerBank primers
Although all PrimerBank primers are designed to be gene specific, the choice
of PCR conditions is important and has a major impact on the success rate.
Non-specific primer extension of only a few bases at room temperature by
Taq polymerase can lead to non-specific PCR amplifications. Therefore,
some variety of hot-start PCR is strongly recommended. AmpliTaq Gold®
DNA polymerase has been our preferred enzyme as we found it to be more
specific than other hot-start DNA polymerases we tested.
The annealing temperature may affect PCR specificity. To avoid non-
specific PCR products, a high annealing temperature is recommended. In
general, the annealing temperature should be at least 55ºC or higher. Here
we present a standard SYBR® Green real-time PCR protocol using
PrimerBank primers. A more detailed and complete protocol is also
presented in Chapter 7.
5.3.1 Reverse transcription (RT)
We have tested Invitrogen’s SuperScript™ First-Strand Synthesis System and
Ambion’s RetroScript™ RT kit for cDNA synthesis from total RNA. Both kits
produce high-quality cDNA templates for real-time PCR. Random primers
are recommended in RT reactions because they provide full transcript
102 Real-time PCR
(A)
(B)
0.8
1a2
0.7 2a5
Fluorescence signal derivative
0.6 2b9
0.5 2b13
2c29
0.4
2c38
0.3
0.2
0.1
0
–0.1
70 72 74 76 78 80 82 84 86 88 90
Melting temperature (°C)
Figure 5.3
Real-time PCR primer validations for 16 cytochrome P450 genes.
A. PCR amplifications of 16 cytochrome P450 genes. Lane 1: 25 bp DNA
ladder; lane 2–17: 10 μl PCR products of P450 1a2, 2a5, 2b9, 2b13, 2c29,
2c38, 2c40, 2d26, 2d1, 2j5, 3a16, 3a25, 4a10, 4a12, 4a14, and 7a1.
B. Melting curves of 6 genes from cytochrome P450 family 1 and 2 (plotted as
the first derivative of the absorbance with respect to temperature). Adapted
from Nucleic Acids Research 31(24): e154 with permission.
coverage. The random priming approach gives highest detection sensitivity
toward the 5’ end of the sequence.
5.3.2 Real-time PCR
We recommend using SYBR® Green PCR Master Mix from Applied
Biosystems.
High-throughput primer and probe design 103
1. Mix the gene-specific forward and reverse primer pair. Each primer
(forward or reverse) concentration in the mixture is 5 pmol/μL.
2. A real-time PCR reaction volume can be either 50 μL or 25 μL. Prepare
the following mixture in each optical tube. Do not use more than 1 μL
cDNA template.
• 25 μL SYBR® Green Mix (2x)
• 0.5 μL cDNA template
• 2 μL primer pair mix (5 pmol/μL each primer)
• 22.5 μL H2O
or
• 12.5 μL SYBR® Green Mix (2x)
• 0.2 μL cDNA template
• 1 μL primer pair mix (5 pmol/μL each primer)
• 11.3 μL H2O
3. Set up the experiment on a real-time PCR machine with the following
PCR program.
1) 50°C 2 minutes, 1 cycle
2) 95°C 10 minutes, 1 cycle
3) 95°C 15 seconds → 60°C 30 seconds → 72°C 30 seconds, 40 cycles
4) 72°C 10 minute, 1 cycle
5.3.3 Troubleshooting
Below are a few commonly encountered problems in the use of real-time
PCR using PrimerBank primers.
5.3.4 Little or no PCR product
Poor quality of PCR templates, primers, or reagents may lead to PCR failure. It is
important to always include appropriate PCR controls to identify these possi-
bilities. Some transcripts are expressed transiently or show tight lineage-specific
regulation. In this regard an important caveat is that microarrays sometimes
produce misleading information about gene expression levels, particularly
when the inferred transcript abundance is low. False positives are relatively
common when low microarray hybridization signal is observed. After switching
to appropriate templates, we have obtained positive results following what
initially appeared to be primer failures (Wang and Seed, 2003a).
5.3.5 Poor PCR amplification efficiency
The accuracy of real-time PCR is highly dependent on PCR efficiency. The
amplification efficiency should be at least 80%. Following an inefficient
PCR reaction the asymptotic value (plateau) for the final fluorescence inten-
sity in the amplification curve is significantly lower than that seen with
other reactions. If this is the case, the primers should be re-synthesized.
5.3.6 Primer dimer
Primer dimer may be observed if the gene expression level is very low. In
this case, increasing the template amount may help in eliminating primer
104 Real-time PCR
dimer formation. Primer dimer formation is a greater problem if the PCR is
not conducted under hot-start conditions and the annealing temperature is
less than 60ºC.
5.3.7 Multiple bands on gel or multiple peaks in the melting
curve
Agarose gel electrophoresis or melting curve analysis may not always
reliably measure PCR specificity. Based on our experience, bimodal melting
curves are sometimes observed for long amplicons (>200 bp) even when the
PCRs are specific. The observed multiple peaks may be the result of ampli-
con sequence heterogeneity rather than non-specificity. On the other hand,
for short amplicons (<150 bp) very weak and fussy bands migrating ahead
of the major specific bands are sometimes observed on agarose gel. These
weak bands are super-structured or single-stranded version of the specific
amplicons in equilibrium state and therefore should be con-
sidered specific. Although gel electrophoresis or melting curve analysis
alone may not be 100% reliable, the combination of both can always reveal
PCR specificity in our experience.
5.3.8 Non-specific amplification
Non-specific amplicons, identified by both gel electrophoresis and melting
curve analysis, lead to inaccurate real-time PCR results. To avoid this problem,
please make sure to perform hot-start PCR and use 60°C annealing tempera-
ture. We have noticed that not all hot-start Taq polymerases are equally
efficient at suppressing polymerase activity during sample set-up. AmpliTaq
Gold® DNA polymerase is highly recommended. If the non-specific amplicon
is persistent, you have to choose a different primer pair for the gene of
interest. This primer design failure is usually the result of mispriming to a
previously unidentified splice isoform (Wang and Seed, 2003a).
5.4 Web resources about primer and probe design
5.4.1 Real-time PCR primer and probe databases
• PrimerBank (http://pga.mgh.harvard.edu/primerbank). PrimerBank is a
public database of real-time PCR primers. PrimerBank contains over
300,000 primers covering most known human and mouse genes.
• Other primer and probe databases. These databases are collections of
validated real-time PCR primers and probes.
RTPrimerDB (http://medgen.ugent.be/rtprimerdb)
Real-Time PCR Primer Set (http://www.realtimeprimers.org)
QPPD (http://web.ncifcrf.gov/rtp/gel/primerdb/default.asp)
5.4.2 Primer and probe design tools
• Primer3 (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi).
Primer3 is a popular free design tool for PCR primers and probes. Users
can customize many PCR parameters.
High-throughput primer and probe design 105
• Primer Express® (http://www.appliedbiosystems.com). This is a com-
mercial desktop program from Applied Biosystems. It is widely used for
design of TaqMan primers and probes.
• Premier Biosoft International (http://www.premierbiosoft.com). This is a
commercial web site for real-time PCR primer and probe design.
5.4.3 Other useful web sites
• Protocol Online (http://www.protocol-online.org). This web site has a
large collection of biological protocol links including the ones for real-
time PCR.
• Real-Time PCR Review (http://www.dorak.info/genetics/realtime.html).
This is a review article with many links about real-time PCR.
• Bioinformatics.net (http://www.bioinformatics.vg). This is a useful
gateway to many bioinformatics tools. It has a collection of program
links for PCR primer design.
• Gene-Quantification Info (http://www.gene-quantification.de/primers.
html). This is a web site dedicated to real-time PCR technology. The
primer page contains a list of design programs for real-time PCR.
• Public Health Research Institute (http://www.molecular-beacons.org).
This is a comprehensive web site dedicated to the Molecular Beacon
technology.
• QPCR Listserver (http://groups.yahoo.com/group/qpcrlistserver). This is
a popular discussion group about practical issues related to real-time
PCR.
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment
search tool. J Mol Biol 215: 403–410.
Breslauer KJ, Frank R, Blocker H, Marky LA (1986) Predicting DNA duplex stability
from the base sequence. Proc Natl Acad Sci USA 83: 3746–3750.
Hancock JM, Armstrong JS (1994) SIMPLE34: an improved and enhanced implemen-
tation for VAX and Sun computers of the SIMPLE algorithm for analysis of
clustered repetitive motifs in nucleotide sequences. Comput Appl Biosci 10: 67–70.
Huang MM, Arnheim N, Goodman MF (1992) Extension of base mispairs by Taq
DNA polymerase: implications for single nucleotide discrimination in PCR.
Nucleic Acids Res 20: 4567–4573.
Mount DW (2001) Bioinformatics: sequence and genome analysis. Cold Spring Harbor
Laboratory Press, New York.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press, New York.
SantaLucia J, Jr (1998) A unified view of polymer, dumbbell, and oligonucleotide
DNA nearest-neighbor thermodynamics. Proc Natl Acad Sci USA 95: 1460–1465.
Tyagi S, Kramer FR (1996) Molecular beacons: probes that fluoresce upon hybridiza-
tion. Nat Biotechnol 14: 303–308.
von Ahsen N, Wittwer CT, Schutz E (2001) Oligonucleotide melting temperatures
under PCR conditions: nearest-neighbor corrections for Mg(2+), deoxynu-
cleotide triphosphate, and dimethyl sulfoxide concentrations with comparison
to alternative empirical formulas. Clin Chem 47: 1956–1961.
Wang X, Seed B (2003a) A PCR primer bank for quantitative gene expression
analysis. Nucleic Acids Res 31: e154.
106 Real-time PCR
Wang X, Seed B (2003b) Selection of oligonucleotide probes for protein coding
sequences. Bioinformatics 19: 796–802.
Zuker M (2003) Mfold web server for nucleic acid folding and hybridization predic-
tion. Nucleic Acids Res 31: 3406–3415.
Quantitative analysis of
ocular gene expression
Stuart N. Peirson
6
Summary
This chapter addresses a range of problems that arise with quantifying gene
expression with quantitative PCR (qPCR), drawing upon the author’s
experience using the eye as a model system. The eye (or more specifically
the light-sensitive retina), as well as mediating the primary events of vision,
provides an accessible model of the nervous system. However, the light-
sensitive nature of this tissue makes analysis of ocular tissues difficult as
dynamic changes in gene expression may occur during tissue collection.
The diverse cellular makeup of the retina also presents a problem in the
form of assessing gene expression in a heterogeneous tissue. When dealing
with models of retinal degeneration, these problems are compounded by
very small tissue samples and, furthermore, when the pathways of interest
involve numerous transcripts, high-throughput assays become essential.
To address some of these issues, a kinetic approach to high-throughput
relative quantification of gene expression has been successful. This chapter
covers topics such as assay design and power analysis, RNA extraction and
quality assessment, use of suitable internal controls, approaches to data
analysis, and methods of ensuring comparable amplification efficiency
across all samples, all of which are vital for successful qPCR. Most of these
issues are not unique to the eye, and as such the aim of this chapter is to
provide generalized advice for researchers using qPCR, as well as demon-
strating how qPCR assays may be optimized for specific research challenges.
6.1 Introduction
The following section provides an introduction to the eye as a model
system, as well as some of the problems facing researchers using this model.
The aim of this introduction is to highlight how the sample under analysis
should be considered prior to the implementation of a quantitative assay,
thus minimizing tissue-specific problems that may bias subsequent results.
6.1.1 Gene expression in the eye
The mammalian eye is in many respects similar to the eyes of most other
vertebrates, consisting of a focal apparatus, the pupil and lens, that direct
light onto the photosensitive retina to produce an image. The retina is a
discretely layered structure containing two primary classes of photoreceptive
108 Real-time PCR
cells, the rods and cones, which appose the retinal pigment epithelium. The
additional proximal layers of the retina consist of secondary neurons and
their processes, and are involved in the first steps of visual processing. The
output from the retina is via the axons of the retinal ganglion cells which
form the optic nerve, projecting to the visual centers of the brain. In
addition to the primary image-forming role in vision, recent studies have
highlighted an additional photoreceptive pathway within the eye, based
upon directly light-sensitive retinal ganglion cells expressing the photopig-
ment melanopsin (Provencio et al., 2000; Berson et al., 2002; Sekaran et al.,
2003; Foster and Hankins, 2002). This pathway is involved in detecting gross
changes in light levels (irradiance) and is involved in the regulation of circa-
dian rhythms as well as regulating other non-image forming tasks such as
the pupillary light response and acute suppression of pineal melatonin
(Lucas et al., 2001; Lucas et al., 1999).
The eye, and more specifically the retina, forms an ideal substrate for the
study of neural physiology, as it forms a discrete outpost of the central
nervous system, containing a wide range of neurons specialized to a variety
of different tasks (Dowling, 1987). Investigating patterns of gene expression
within the eye is therefore an essential aspect of the analysis of retinal
physiology. qPCR provides an ideal tool for the investigation of temporal
changes in gene expression in response to stimuli, as well as enabling
characterization of pathways involved in retinal development and retinal
degeneration.
6.1.2 Problems associated with ocular gene expression
Analysis of gene expression in ocular tissues has highlighted a number of
potential problems, some of which are specific to the eye, and others that
are not unique to this tissue. These may be broadly summarized as:
a) light sensitivity
b) RNA quantity
c) RNA quality
d) cellular heterogeneity
e) multiple target genes
f) biological variance
These problems are expanded upon below, and possible resolutions are
discussed in the following sections.
Light sensitivity
The first major obstacle to the study of ocular tissues is their light-sensitivity.
The manner in which ocular tissues are collected may alter the expression of
the transcripts of interest. This scenario is not unique to the eye. As changes
in gene expression are dynamic, the methods used to dissect tissues or dis-
sociate cell types may consequently affect the expression of either target or
internal control genes (Dougherty and Geschwind, 2005). This technical
consideration is rarely controlled for, and may result in potentially mislead-
ing data. These problems are compounded when temporal changes in gene
Quantitative analysis of ocular gene expression 109
(A) DR IR
10.0000
Log relative sensitivity
1.0000
Blue cone
0.1000
Rod
Green cone
0.0100
Red cone
0.0010
0.0001
300 400 500 600 700 800
Wavelength (nm)
(B) DR IR
10.0000
Log relative sensitivity
1.0000
0.1000 UV cone
Rod
0.0100 Green cone
0.0010
0.0001
300 400 500 600 700 800
Wavelength (nm)
Figure 6.1
Spectral sensitivity profiles for human A. and mouse B. visual pigments. Data
plotted on logarithmic scale. Arrows indicate dim red stimulus, at 600 nm (DR)
and longer-wavelength infra-red stimulus at 700 nm (IR), illustrating the
increased long-wavelength sensitivity of the human visual system conferred by
the presence of the red cone class. Visual pigment profiles based upon
Govardoskii template (Govardovskii et al., 2000). λmax values taken from Dartnall
et al. (1983), Jacobs et al. (1991), Bridges (1959) and Sun et al. (1997).
expression are of interest, as not only tissues must be collected without light
exposure, but they must be collected rapidly to prevent changes in gene
expression or RNA degradation (see ‘RNA quality’ below).
Visual scientists have traditionally collected tissues under dim red light
(>600 nm) to minimize the effects of photopigment activation. For many
studies, this works extremely well, although it should be noted that the
success of this approach is dependent upon the species and its innate
110 Real-time PCR
photoreceptor complement in comparison to human spectral sensitivity.
The visual sensitivity functions of photopigments can extend well into the
long-wavelength region of the spectrum and use of even dim red light may
result in a significant absorption by the LWS cones of some species. Figure
6.1 illustrates the photopigment complements of humans (A) and mice
(B), illustrating the difference in long wave sensitivity between these
species.
RNA quantity
RNA yields may be variable, and for models of retinal degeneration, where
the outer retina is lost, tissue yields may be very low. qPCR is ideal for the
analysis of such small samples, and due to the sensitivity of the technique,
pooling samples to obtain enough RNA should not be necessary. This is an
important consideration, as it enables gene expression to be determined on
an individual basis, enabling biological variance in gene expression to be
assessed.
RNA quality
RNA degradation is a major problem with qPCR, as it introduces additional
variability between samples that must be subsequently accounted for. Even if
using equal quantities of RNA for each reverse transcription, differences in
RNA quality may render samples incomparable without normalization (see
Section 6.2 below). RNA quality may be adversely affected by tissue collection
protocols as discussed above (see ‘Light sensitivity’ above), as well as freeze-
thawing or improper storage, all of which give endogenous RNases the oppor-
tunity to degrade the RNA within the sample. Furthermore, the addition of
exogenous RNases from contaminated plasticware and laboratory surfaces is
all too easy due to the ubiquitous nature of these enzymes and their resilience
to many forms of denaturation (Sambrook and Russell, 2001).
Cellular heterogeneity
Like most tissues, the eye as a structure contains a great diversity of cell
types. These range from the cells of the lens and the iris, to the melanin-
containing retinal pigment epithelium, the cells of the choroid and retinal
vasculature, and of course the numerous photoreceptors, neurons and
supportive Muller cells of the retina. Such cellular heterogeneity will restrict
the detection of changes in gene expression, as if a transcript is expressed in
a rare cell type, even a massive change in expression may be undetectable as
it reflects only a small fraction of the RNA population measured.
Alternatively, changes in gene expression in one cell type may be masked
by compensatory changes in other cell types, for example rhythms of gene
expression in anti-phase. Even when changes in expression can be detected
in heterogeneous tissues, determining the source of the change may be
impossible. Overall changes could be due to a change in all cells within the
tissue, a change in only a fraction of the cells, a change in the cellular
makeup of the tissue, e.g., neuronal loss, reactive gliosis or invasion of
inflammatory cell types (Dougherty and Geschwind, 2005).
Quantitative analysis of ocular gene expression 111
The counterpoint to these problems is that dissection or dissociation of
specific compartments or cell types may affect the dynamic expression
profile within the tissue. Reduction in starting tissue volume will also result
in a decreased RNA yield and may even necessitate pooling individual
samples, resulting in a decreased sample size or, in the worst case scenario,
a single pooled sample. Moreover, the dissociation of cell types within
heterogeneous tissues may lead to cell damage and release of endogenous
RNases that will compromise RNA quality. Finally, the tissue yield obtained
even from similar samples may be more variable following dissection or
dissociation. This is certainly the case with retinal dissection, as the whole
eye represents a discrete organ, and even given very careful dissection,
retinal yields are considerably more variable.
As such, the use of heterogeneous tissues presents a trade-off between the
problems of studying mixed cell populations and the problems of intro-
duced variance and potential RNA loss associated with producing cell-
specific populations.
Multiple target genes
Due to the ever-increasing knowledge of intracellular signaling pathways, it
is often desirable to examine multiple transcripts of interest within the
same biological samples. This is taken to extremes in the case of micro-
arrays, where it is now possible to examine the whole transcriptome from a
single sample. qPCR retains its essential place in the canon of molecular
techniques, as in the majority of studies, candidate genes are already known
or implicated. The need to examine the expression of multiple transcripts is
evident within several pathways within the eye, including photopigment
complements, elements of the phototransduction cascade, inflammatory
markers, markers of neuronal activity and clock genes. High-throughput
approaches are therefore essential to face the rising number of candidates,
making approaches based upon the construction of accurate exogenous
controls cumbersome and rate-limiting.
The need to examine multiple transcripts places an effective limit on the
number of genes which may be examined from any single sample. 1 μg of total
RNA should provide enough cDNA for at least 20 target genes to be investi-
gated, but with extended pathways of interest, the use of multiple internal
controls or with low RNA yields, this can quickly become a limiting factor.
Biological variance
A common problem facing researchers investigating gene expression is
that of biological variance. Even when factors such as genetic background
and environment may be controlled, biological variance will exist between
individuals (Pritchard et al., 2001), resulting in noisy data and necessitat-
ing large sample sizes. Whilst many qPCR platforms enable 96-sample
formats, many researchers utilize sample replicates, typically triplicates, to
ensure each data point is well-resolved. The use of large samples may
become problematic due to inter-assay variability, as data from samples
split across different experimental runs is more difficult to directly
compare.
112 Real-time PCR
6.2 Relative quantification
Like many basic research applications, analysis of ocular gene expression is
particularly amenable to relative quantification using qPCR (Bustin, 2000;
Bustin, 2002; Ginzinger, 2002; Klein, 2002; Walker, 2002) (also discussed in
Chapters 2 and 3). This involves calculating changes in gene expression
relative to a control population, which should be present in the majority of
experimental designs. The control population is totally dependent upon
the type of study, and may, for example, be an untreated group (in stimulus
or drug-treatment regimes), a specific tissue or cell type (in cross tissue/cell
studies), time point zero (in time course studies), wildtype (in transgenic
studies) or a specific age group (in developmental or aging studies). Changes
are then expressed as a fold change relative to this control population.
6.2.1 The R0 method
Relative quantification may be most easily carried out using the 2–ΔΔCt
method (Livak, 1997; Livak and Schmittgen, 2001). The necessary calcula-
tions may be simplified by use of the term R0, the theoretical starting
fluorescence. This concept is most easily understood by thinking of the
reaction as a simple exponential amplification with a doubling of product
every cycle. If both the fluorescence at a common threshold (termed Rn),
and the number of cycles required to reach this threshold is known (the
threshold cycle, Ct ), then it becomes a simple matter to back-calculate to
the starting fluorescence, R0 (Figure 6.2). As the fundamental concept of real-
time PCR is that fluorescence is proportional to the DNA concentration
1.00E+01 Ct
䊉䊉䊉䊉
䊉䊉䊉䊉
䊉䊉
䊉
䊉
䊉
1.00E–01 䊉
Log fluorescence (Rn)
䊉 Threshold (Rn)
䊉
䊉
䊉
䊊 䊉
1.00E–03 䊊䊊 䊊 䊊 䊊 䊉
䊊 䊊 䊊
䊊
䊊
1.00E–05
1.00E–07
R0
1.00E–09
0 10 20 30 40
Cycle
Figure 6.2
The starting fluorescence (R0) method. If threshold (Rn), threshold cycle (Ct ) and
amplification rate (E) are known, then the fluorescence at cycle 0 can be
determined (R0), using eq. 2. In this example Rn = 0.153, E = 0.893 and Ct =
28.00, giving a value of R0 = 2.67 × 10–9. Several methods may be used to
determine E, including standard curves, assumed 100% E or kinetic approaches.
Quantitative analysis of ocular gene expression 113
within a reaction, R0 reflects the expression within that sample. This may be
expressed as:
R0 = Rn × 2–Ct eq. 1
The main advantage of such an algebra rather than using the 2–ΔΔCt method
is that it simplifies subsequent calculations, particularly those involving
statistical calculations such as standard deviations. Transformation of
expression values into a linear series rather than use of Ct values results in a
data set which are more intuitive for subsequent manipulation.
Consequently, normalization of data to an internal control (implicit within
the 2–ΔΔCt equation) involves simply dividing the individual sample target
gene R0 values by their respective internal control gene R0 values. This
approach facilitates the use of multiple internal controls, as discussed
below.
This approach should be unaffected by changes in the threshold (Rn), as a
change in Rn will result in a corresponding alteration of Ct, and the R0 value
should remain unchanged; e.g. if Rn = 0.05 and Ct = 21.3, then R0 = 1.94 ×
10–8. If Rn is increased to 0.10, then Ct = 22.3, and R0 =1.94 × 10–8. This is of
course an over-simplification, as amplification efficiency dynamically
changes throughout the course of a PCR. However, this approach offers a
simple means of investigating how the placement of the threshold affects
the data obtained (see below).
This approach can also simply incorporate efficiency corrections, such as
those described by Pfaffl (2001). By conducting a cDNA standard curve, the
amplification efficiency (hereafter, termed E) for an individual
primer/probe set may be determined, and incorporated as a correction to
improve accuracy:
R0 = Rn × (1+E)–Ct eq. 2
Reaction efficiency may be determined by constructing a standard curve
based upon the serial dilution of a sample of known concentration. This
may be a plasmid, oligonucleotide or a cDNA sample, where Ct is plotted on
the y-axis and logarithm (base 10) concentration is plotted on the x-axis. E
may be derived from a standard curve using the following formula:
E = 10(–1/S) eq. 3
Where E equals the amplification efficiency and S is the slope of the
standard curve (which should be a negative slope). E may also be derived
from the kinetics of the reactions under analysis, as described in Section
6.2.2.
Finally, it should be noted that the R0 method is mathematically equiva-
lent to the 2–ΔΔCt as well as standard curve methodologies, and will result in
identical fold changes when using the same E (Peirson et al., 2003). The
main factor that therefore differs between these commonly used
approaches to data analysis is the means by which E is derived. Another
difference is of course the units, but if normalization to an internal control
is conducted then the units will effectively cancel out, resulting in a ratio of
114 Real-time PCR
target gene to internal control gene expression. This approach represents no
great novelty in qPCR data analysis, but enables a simple common method-
ology for data analysis to be implemented.
6.2.2 Kinetic approaches to qPCR
Whilst the term kinetic PCR was originally used for what is now more
commonly referred to as real-time PCR (Higuchi et al., 1993; Higuchi and
Watson, 1999), it has come to be used to describe those approaches to qPCR
where the reaction efficiency is derived from the kinetics of the samples
under analysis. A number of approaches to kinetic PCR have been proposed
(Liu and Saint, 2002a; Liu and Saint, 2002b; Tichopad et al., 2002; Ramakers
et al., 2003, Peirson et al., 2003), though the main consideration of such
approaches here is that they enable E to be derived without the use of
additional standards. At their simplest form, kinetic approaches involve
calculating the slope of an amplification plot to determine E (Figure 6.3A).
The region of the amplification plot used for kinetic analysis presents a
similar problem to threshold setting. If the region used is too low then E
will be inaccurate due to background noise, and too high, then E will be
too low as the reaction will be approaching a plateau (Kainz et al., 2000).
This raises the concern of selecting an ‘optimum threshold’ for both
kinetic analysis and threshold setting, which is a trade-off between
background noise and plateau effects (Peirson et al., 2003). Changing the
placement of a threshold will therefore affect the R0 value obtained. The
nature of these inaccuracies is dependent upon the data under analysis.
Analysis of the c-fos data presented in Peirson et al. (2003) suggests that a
two-fold change in the threshold only alters the R0 value by less than 2%
of its midpoint value, a five-fold change in threshold yields around a 6%
change, and a ten-fold change in threshold results in a change of around
18%. In all cases, lowering the threshold created a larger deviation in R0
value than increasing it, illustrating that the placement of a threshold too
close to background noise may introduce considerable errors when evalu-
ating expression levels by qPCR. This possible source of assay noise also
suggests that platforms with a narrow fluorescent signal range between
background noise and reaction plateau may be more prone to errors intro-
duced due to threshold placement.
An advantage of kinetic approaches is that the individual E values may be
used as a criterion for outlier detection and sample exclusion. As the raw
data from qPCR is in the form of Ct values, even a small amount of noise
associated with these measurements may result in the introduction of large
systematic errors. Bar et al., (2003) suggested the use of kinetic outlier detec-
tion (KOD) to circumvent this problem, whereby aberrant kinetics may be
detected based upon deviations of E from a training set (Figure 6.3B).
Problems with kinetic approaches include that such approaches may only
be possible on certain platforms where there is a wide fluorescent signal
range between background noise and reaction plateau. If this signal range is
low, limits are imposed on the amount of data available for kinetic analysis,
and such analysis may be inaccurate. Similarly, inappropriate background
subtraction may affect the slope of amplification plots, with over-
subtraction creating artificially high values for E (Bar et al., 2003).
Quantitative analysis of ocular gene expression 115
(A) 1.00E+01 (B)
1.00
䊊䊊䊊䊊䊊
Amplification efficiency
䊊䊊
Log fluorescence (Rn)
䊊 0.95
䊊
䊊
䊊 䊉
䊉 0.90 䊉 䊉 䊉
1.00E–01 䊉 䊉 䊉 䊉 䊉 䊉
䊉
䊉 䊉
䊉
0.85 䊉 䊉 䊉
䊊
䊊 Slope 0.80 䊉
䊉
䊊 䊊
1.00E–03 䊊䊊䊊 䊊 䊊 䊊 0.75
䊊
䊊 䊊
0.70 Outlier
䊊
0.65
䊊
1.00E–05 0.60
0 10 20 30 40 1 2 3 4 5 6 7 8 9 10 111213 141516
Cycle Sample
Figure 6.3
Kinetic qPCR. A. Use of linear regression to determine slope of amplification
plot. Slope was determined in the region indicated by the filled circles,
providing a slope of 0.277. Amplification efficiency (E) = 100.277 = 0.893. B.
Amplification efficiency (E) determined from the kinetics of 16 ocular samples
(circles), with kinetic outlier detection limits indicated by horizontal lines.
Sample 5 demonstrated abnormally low E, and was therefore excluded from
further analysis.
Kinetic approaches appear to offer the promise of correcting each sample
for slight differences in their individual amplification rates. However, this is
unfortunately a false hope, as any calculation of E from raw data, like any
measurement, is only an estimate, limited by the precision of the measuring
device. Due to the technical noise present within the raw data, data pre-
processing as well as the algorithm used, E will vary, and based upon the
sum of errors from multiple sources, theoretically should conform to a
normal distribution. As shown in eq. 2, the efficiency correction is applied
as an exponent, and therefore even small differences in E will produce
enormous differences in R0. For example, a 1% difference in the efficiency
used will produce around a 13% difference in R0 after 26 cycles, whereas a
5% difference will produce nearly a two-fold change (Freeman et al., 1999).
As such, the optimum approach is to use the mean efficiency (ideally after
KOD), which if based on repeated measures, should provide an accurate
estimate of E.
Consideration of this problem also suggests that the main source of inter-
assay variability in any form of qPCR is due to the method used to calculate
E between experiments. A standard curve run on multiple consecutive days
will never provide exactly the same E, due to the presence of cumulative
small errors in, for example, spectrophotometry, pipetting and fluorescent
measurement. Once again, barring dramatic outliers, such errors would be
expected to result in values of E that conform to a normal distribution.
The kinetic approach described above, based on use of the R0 method is
automated in DART-PCR, an Excel®-based worksheet for qPCR data analysis.
This is available as supplementary data from Peirson et al., (2003), or freely
available on request.
116 Real-time PCR
6.2.3 Accurate normalization
Relative quantification of gene expression is dependent upon accurate
normalization of data to one or more internal controls (ICs), which are
typically housekeeping genes present and unchanged in all samples
(Sturzenbaum and Kille, 2001). Issues related to normalization are discussed
in greater detail in Chapter 4.
What is the most suitable internal control for qPCR? Unfortunately, no
simple answer exists, as every IC has its own benefits and limitations, and
what may be ideal in one experimental scenario may be unsuitable in others.
Arguably, the most sensible approach to qPCR data normalization was
provided by Vandesompele et al. (2002), who recommended using multiple
ICs, enabling the reliability of these control genes to be assessed against each
other. The geometric mean of the most reliable genes is then used in the
form of a normalization factor (NFx, where x is the number of ICs used),
which is less susceptible to distortion by outliers than the arithmetic mean.
Comparing internal controls
A quick method of checking the reproducibility of ICs is to plot the R0 values
as a line graph, which given equal amounts of high quality RNA across all
samples, should give a straight line. This is of course an ideal, and due to
differences in RNA quality, spectrophotometric inaccuracy, differences in RT
efficiency and biological variance, such a plot is likely to be far from linear.
However, a second IC conducted on the same cDNA should provide a similar
profile if IC expression accurately reflects RNA loading, and indeed this is the
case (Figure 6.4A). As the level of IC expression may differ quite dramatically,
samples should be normalized to the mean to transform the data to a
common scale. Additional ICs should provide comparable profiles, with
deviations due to differential regulation, differences in expression variance
and measurement errors. The presence of a common pattern of expression
with different ICs should be representative of RNA loading, and differences
in the expression profile of ICs may indicate that one of the ICs is affected by
the experimental procedure. Such an approach provides additional confi-
dence that the normalization procedure used is in fact reliable.
A quick method of checking the suitability of ICs is to calculate the mean
squared error (MSE) of the expression for each sample (mean normalized as
noted above). This is simply a measure of the within sample variance,
which will be low if the expression patterns of all IC genes are comparable
across all samples, and high if the expression profiles are dissimilar. The
contribution of each IC and each sample to the total sum of squares (SStotal)
can be used to determine which samples and/or genes are the greatest
source of variance, and may be applied as a basis for sample or IC exclusion
(Figure 6.4B and 6.4C, respectively).
Advantages of accurate normalization
What is the advantage of additional ICs? One may consider that the variabil-
ity between the expression of any two samples is due to three factors: (1) true
differences in expression, (2) differences in the RNA content of the sample,
Quantitative analysis of ocular gene expression 117
(A) 2.5 䉱 18S rRNA
Mean-normalised expression
䊏 ARP
2.0
䊉 䊉 b-actin
䊏
䉬
1.5 䉬 Geomean
䉱
䊉
䊏 䉱
1.0 䉬 䉬
䉱 䊉 䊉
䉬 䉱
䊏 䊏
0.5 䉬
䊉
0.0
1 2 3 4 5
Sample number
(B) 50%
Contribution to total SS (%)
40%
30%
20%
10%
0%
1 2 3 4 5
Sample number
(C) 100%
Contribution to total SS (%)
80%
60%
40%
20%
0%
18S rRNA ARP b-actin
Internal control
Figure 6.4
Comparison of expression levels of three internal control (ICs) genes across in
5 samples of murine retina. ICs used are: 18S rRNA, acidic ribosomal
phosphoprotein (ARP) and β-actin. A. IC expression corrected to the mean
expression of that IC across all five samples, illustrating similar profiles of
expression for all three genes. The geometric mean of all three genes is also
shown. B. The variance within each sample can be measured, and the
contribution to the total sum of squares (SStotal) determined. Sample 1
demonstrates the greatest contribution to the contribution to the SStotal, whereas
Sample 3 demonstrates the highest correlation between expression values.
C. Contribution to SStotal by gene, showing that 18S rRNA demonstrates a
greater variance than either ARP or β-actin.
118 Real-time PCR
and (3) measurement errors. True differences in expression will reflect basal
expression levels as well as changes in response to stimuli, and will include
biological variation (6.1.2). It is this level of expression that is the desired
endpoint of any experiment. Measurement errors are present in any assay,
and should be minimal with most qPCR platforms when analyzing samples
in parallel (ideally well below 10%). Differences in RNA load can have a
dramatic effect upon the normalized expression. Poor normalization can
produce quite misleading data, and for this reason the use of at least two ICs
is recommended to ensure that the results obtained are not simply an artifact
of normalization. Use of additional ICs also will provide a more accurate
measure of RNA loading, and this should ensure that this source of error is
minimized. The end result should be a reduction in the overall noise,
enabling an improved assay resolution and a better ability to discriminate
differences. Or in simple terms, more ICs should result in smaller error bars.
6.3 Assay considerations
The final section of this chapter aims to bring together the problems arising
with the analysis of ocular gene expression (6.1) with the approaches to
data analysis described above (6.2) to provide potential solutions that may
enable researchers to obtain the most reliable data with the minimum
expenditure of resources.
Assay design
Most researchers typically think about the application of statistics after an
experiment has run and the data have been collected. However, using statis-
tical methodology before an assay is conducted enables the researcher to get
some idea of whether what they are attempting to measure is feasible, and
that the sample size used will be suitable for the system studied. Both time
and resources may be wasted without such consideration.
Power calculations are based upon the statistical values α and β. The α of
a test is the probability of a false positive, that is, the test indicates a signif-
icant difference where one does not in fact exist. This is typically set to 0.05,
and a p-value below this is taken as evidence of a significant difference. β
indicates the reverse scenario, where the test indicates no significant differ-
ence when a real difference does occur. The power of a statistical test is 1-β,
and represents the ability of the test to detect a difference when it really
does exist. As such, a high power indicates that the test is likely to detect a
real difference if one exists, and a low power suggests that the test will not
be capable of detecting a real difference. Unlike α, in experimental biology
β is typically set to around 0.20, as false negatives are typically deemed less
detrimental than false positives. However, certain assays may require higher
β values, so the context of the assay is a critical factor. For example, in clini-
cal detection of disease, a false negative indicates that a patient has a disease
but the disease is not diagnosed, and as such a low β and therefore a higher
power would be essential (Bland, 2000; Ott and Longnecker, 2001).
The power of a test may be estimated before conducting experiments, and
this can provide researchers with an indication as to whether their experi-
mental design is sufficiently robust to detect the differences in expression
Quantitative analysis of ocular gene expression 119
Table 6.1 Calculation of the sample size required to detect a given change
in gene expression, using power calculations based upon a two-tailed
t-distribution for specified degrees of biological variance (expressed as
coefficient of variance). Calculations conducted using
http://www.univie.ac.at/medstat.
Power 0.80
Biological variance (CV%)
10% 20% 30% 40% 50%
1.1 8 32 71 126 197
Fold change detectable
1.2 2 8 18 32 50
1.3 1 4 8 14 22
1.4 1 2 5 8 13
1.5 1 2 3 6 8
1.6 1 1 2 4 6
1.7 1 1 2 3 5
1.8 1 1 2 2 4
1.9 1 1 1 2 3
2.0 1 1 1 2 2
Power >0.95
Biological variance (CV%)
10% 20% 30% 40% 50%
1.1 13 52 117 208 325
Fold change detectable
1.2 4 13 30 52 82
1.3 2 6 13 24 37
1.4 1 4 8 13 21
1.5 1 3 5 9 13
1.6 1 2 4 6 10
1.7 1 2 3 5 7
1.8 1 1 2 4 6
1.9 1 1 2 3 5
2.0 1 1 2 3 4
they are looking for. The worst case scenario is that experiments are
conducted and no significant difference is found, as real differences may be
present, but the researcher has insufficient evidence to detect them.
Table 6.1 can be used as a quick lookup chart when designing qPCR exper-
iments. These calculations are based upon an unpaired t-test, although
these values will at least provide a guideline for other test procedures,
indicating a suitable sample size. An estimation of biological variance must
first be made, usually as a coefficient of variance (CV = standard deviation
divided by the mean, usually expressed as a percentage). This may be an
estimate based upon previous experiments using a similar tissue and/or
protocol conducted in house or in existing scientific literature. If such infor-
mation is unavailable an approximation may be made, with an estimate
around 30% not being unreasonable. Using the planned sample size, the
table provides the fold change that can be detected with a power of 0.80 (A)
or 0.95 (B). This should enable researchers to decide upon a suitable sample
size for an assay, and to determine the level of resolution that should be
possible with that sample size.
120 Real-time PCR
Tissue collection
For light-sensitive tissues, such as the eye, procedures should ideally be
conducted under infra-red light (>700 nm). Infra-red optical devices are
available from a wide range of suppliers, although complicated dissection is
extremely difficult using such devices, and the exact wavelength of emission
may vary. Lacking such facilities, dim red light may be used if a suitable cut-
off filter is used to prevent stimulation of the photopigments present (see
Figure 6.1). Based on the known long-wavelength sensitivity of human and
mouse visual pigments, use of a light source with a cut-off of 600 nm would
result in absorption of around 60% by the human red cone (certainly
enough to see by), but only around 5% by the mouse green cone, or around
a ten-fold greater sensitivity. Moving up to over 700 nm would result in less
than 1% absorption by the human red cone (detectable at very high intensi-
ties), but over a hundred-fold less absorption by the mouse visual pigments.
Snap-freezing tissues is ideal for RNA extraction, although all dissections
must be conducted before doing so as freeze–thawing can have dramatic
effects on RNA quality (Sambrook and Russell, 2001). One solution to this
problem is the use of an RNA preservation medium, such as RNAlater™
(Ambion). With ocular tissues, the eye can be enucleated under infra-red
light, the eye pierced to facilitate access to the retina, and then placed into
RNAlater™ in a light-tight container. The tissue can then be stored
overnight at 4°C before the retina is dissected out in light.
To validate this approach, we investigated expression of the immediate-
early gene and marker of neuronal activity c-fos in response to a 15 min
light pulse. C-fos expression has been shown to rapidly increase in response
to such a stimulus, corresponding to depolarization of retinal ganglion cells
(Nir and Agarwal, 1993; Yoshida et al., 1993). Dissection of tissues stored in
RNAlater™ followed by qPCR using SYBR® Green I results in a clear induc-
tion of c-fos, peaking at 30 min, as demonstrated previously (Figure 6.5).
RNA extraction protocols
A wide variety of reagents are available for RNA extraction. One of the most
commonly used methods is based upon that of Chomczynski and Sacchi
(Chomczynski and Sacchi, 1987, Chomczynski, 1993), using a monophasic
lysis reagent containing phenol, guanidinium salts and solubulizing agents
(available under different trade-names from a variety of suppliers). This
approach enables simultaneous extraction of RNA, DNA and protein, and is
effective for even small tissue samples.
Use of such monophasic lysis reagents is particularly effective on ocular
tissues, including retina, RPE, lens as well as whole eye, and has also been
applied to a diverse range of tissues throughout the body. When using a
different tissue type for the first time, it is always worth conducting a test
extraction, evaluating RNA quantity and quality to ensure that the RNA
extracted suitable for subsequent studies. Using a monophasic lysis reagent,
it is possible to routinely extract 10–15 μg of high quality total RNA from
paired whole eyes, and 1–5 μg of total RNA from paired retinae. When
studying models of retinal degeneration, these yields decrease, with
0.5–2 μg total RNA being more typical.
Quantitative analysis of ocular gene expression 121
10
***
8
Fold change
6
4
2
0
Sham 30 min 75 min
Light treatment
Figure 6.5
C-fos induction in wildtype retina, dissected from tissue preserved in RNAlater™
(Ambion). Peak expression of c-fos was found 30 min after light pulse
administration. Significant differences were assessed using one-way ANOVA, F2,11
= 13.56, P<0.01 (n = 4–5 per group).
Analysis of RNA samples using a microfluidic system, such as the Agilent
bioanalyzer, enables RNA quality to be assessed with minimum loss of
valuable RNA (Figure 6.6). Such lab-on-a-chip methods typically utilize just
500 ng of RNA, and enable a quantitative measure of RNA quality as well as
quantity.
Reliable normalization
The use of at least two internal controls is recommended, as described
above. If these correlate well, then additional ICs may be unnecessary
(Figure 6.4A). However, if a different profile is found, then it is recom-
mended that additional controls are used. Given that normalization can
have dramatic effects on the results of relative quantification of gene
expression, accurate normalization ensures that researchers do not report
artifacts of normalization which may be misleading. Low expression of an
internal control in just one sample can result in the normalized expression
appearing erroneously higher. Such outliers can have dramatic effects when
small sample sizes are used, and are capable of producing quite misleading
data.
The use of additional metrics, such as gene stability index (Vandesompele
et al., 2002) or the variance of IC expression within samples and across IC
genes as described above (Figures 6.4B and 6.4C) enable a quantitative
approach to IC selection.
Heterogeneous tissues
The trade-off between using discrete tissue masses containing multiple cell
types or attempting to reduce cellular heterogeneity and possibly affecting
122 Real-time PCR
(A) 55
50
45
40
35
Fluorescence
30
25
20
15
10
5 䉬
䉬 䉬
0
18S
ⲑ⬟⺣
19 24 29 34 39 44 49 54 59 64 69
Time (seconds)
(B) 11
10
9
8
7
Fluorescence
6
5
4
3 䉬
䉬
2
1
18S
0
19 24 29 34 39 44 49 54 59 64 69
Time (seconds)
Figure 6.6
Analysis of RNA quality using Agilent Bioanalyser with RNANano chip. A. 500 ng
of total RNA was loaded per well, producing two distinct peaks for the 18S and
28S ribosomal RNA subspecies. B. In degraded samples, RNA fragmentation
produces a shift to smaller molecular weight products. Data courtesy of Helen
Banks.
gene expression or RNA quality presents a major problem with no simple
solution. Without extensive validation to establish the suitability of disso-
ciation/dissection techniques in a variety of experimental scenarios, the
answer remains unclear. Approaches such as fluorescent-assisted cell sorting
(FACS) and laser capture microdissection (LCM) offer potential solutions to
these problems, but validation for specific research applications would still
be required. The best advice would be to ensure that whatever approach is
used, when comparisons are made between tissues both should be isolated
in a similar manner.
Preliminary analysis of c-fos induction within the murine retina using whole
eye or just retinae suggests that both approaches can detect the increase in
Quantitative analysis of ocular gene expression 123
expression (Semo et al., 2003). However, the amplitude of the change is lower
in the whole eye (1.6-fold increase relative to sham) compared with just retinae
(6.8-fold increase) as would be predicted due to a smaller contribution to the
total RNA pool (Dougherty and Geschwind, 2005).
High throughput qPCR
A reverse transcription (RT) reaction containing 1 μg total RNA should yield
enough cDNA for at least 20 genes to be examined. Based upon a total RNA
yield from whole eye of 10 μg, this should provide enough material for 200
transcripts to be examined. In contrast, a retinal extraction yielding 3 μg
will enable 60 transcripts to be profiled.
When approaching the analysis of multiple transcripts in this manner,
the inclusion of an IC on every qPCR run is unnecessary, and simply
consumes reagents and space on a plate. As comparisons for a given
transcript are made relative to each other, normalization to ICs run on
different plates on different days is valid. One way of illustrating this point
is to divide the expression of a target gene to the mean target gene expres-
sion, so that target gene expression is corrected relative to the mean of all
samples. Second, carry out the same procedure for an IC measured for the
same samples, correcting to the mean IC expression. If the mean-corrected
target gene expression is now normalized to the mean-corrected IC expres-
sion, the relative fold change and variance observed between any group of
samples will be preserved. This offers a great advantage for relative quantifi-
cation, as it means that multiple ICs can be used based upon different
experimental runs, and barring quite dramatic freeze–thaw effects, which
may be evaluated by differences in IC profiles, a target gene run one day
may be normalized to a IC run days or even weeks earlier (or later). For this
reason, any samples between which comparisons are to be made should be
included within the same plate to ensure that they are truly comparable.
Once ICs are well-characterized within a group of cDNA samples, and a
normalization factor (NF) is calculated for each sample, this value can be
used to normalize all subsequent target genes. Given the synthesis of 20 μl
of cDNA, and using 1 μl per target gene, a researcher would be wise to first
analyze the expression of two or three (or even more) ICs to ensure that an
accurate NF can be calculated before moving on to investigate up to 16 or
17 target genes. However, if a second RT is performed on the same RNA, re-
deriving the NF is necessary, as differences in the RT efficiency may occur
between the first and second batches of cDNA, and the same relationship
between target gene and IC expression may not hold in the second batch of
cDNA. This raises an unresolved issue with one-step RT-PCR protocols,
where a different reverse transcription is conducted for every reaction.
The use of kinetic approaches to qPCR enables researchers to improve
assay throughput, removing the need for using space on each plate for
standard curves (which may even demonstrate different reaction kinetics to
the cDNA samples under analysis). The use of kinetic data already collected
during the course of a qPCR to determine E, coupled with a two-step proce-
dure of cDNA synthesis with subsequent NF derivation enables researchers
to move from candidate gene to expression profile in a single reaction,
greatly improving assay throughput and saving both time and resources.
124 Real-time PCR
6.4 Conclusions
qPCR provides an ideal method for the rapid quantification of ocular gene
expression. By carefully considering tissue-specific problems, such as light
sensitivity, cellular heterogeneity as well as the consideration of suitable
sample sizes based upon known or expected biological variation,
researchers may save time and resources, enabling a single sample set to be
used for quantification of anything up to a hundred or more transcripts.
Working along similar guidelines, qPCR may be successfully adapted for
the relative quantification of gene expression in any tissue, and the under-
lying principles of assay design, data analysis and normalization of gene
expression are universally applicable. Consideration of such fundamental
aspects of qPCR assays also highlight potential sources of error, such as the
effects of using different amplification efficiencies, threshold values and
blind reliance on single internal control genes for normalization.
Finally, the use of kinetic analysis of qPCR data enables a high-through-
put approach suitable for the rapid quantification of multiple transcripts,
enabling additional measures of quality control to be incorporated. This
approach is ideal for examining extended signaling pathways and valida-
tion of micro-array data, enabling researchers to move from tissue to gene
expression data with unparalleled speed.
Acknowledgments
Many thanks to M. Tevfik Dorak for his kind invitation to contribute to this
project. Additional thanks to Russell G. Foster for his unstinting support in
these studies, as well as to Jason N. Butler for his continued contribution.
Data for Figure 6.2 were kindly provided by Helen Banks. Finally, thanks
must also be extended to all the researchers with whom I have spoken on
the subjects contained herein for providing a constant improvement of my
understanding of this rapidly moving field. Support for this work was
provided by the British Biotechnology and Biological Sciences Research
Council, the Wellcome Trust, and Children with Leukaemia.
References
Bar T, Stahlberg A, Muszta A, Kubista M (2003) Kinetic outlier detection (KOD) in
real-time PCR. Nucleic Acids Res 31: E105.
Berson DM, Dunn FA, Takao M (2002) Phototransduction by retinal ganglion cells
that set the circadian clock. Science 295: 1070–1073.
Bland M (2000) An introduction to medical statistics. Third Edition. Oxford University
Press, Oxford.
Bridges C (1959) The visual pigments of some common laboratory animals. Nature
184: 727–728.
Bustin SA (2000) Absolute quantification of mRNA using real-time reverse transcrip-
tion polymerase chain reaction assays. J Mol Endocrinol 25(2): 169–193.
Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR
(RT-PCR): trends and problems. J Mol Endocrinol 29(1): 23–39.
Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162(1):
156–159.
Quantitative analysis of ocular gene expression 125
Chomczynski P (1993) A reagent for the single-step simultaneous isolation of RNA,
DNA and proteins from cell and tissue samples. Biotechniques 15(3): 532–534,
536–537.
Dartnall HJ, Bowmaker JK, Mollon JD (1983) Human visual pigments: microspec-
trophotometric results from the eyes of seven persons. Proceedings of the Royal
Society London B Biological Science Nov 22, 220(1218), 115–130.
Dowling JE (1987) The retina: an approachable part of the brain. Harvard University
Press, Cambridge, MA.
Dougherty JD, Geschwind DH (2005) Progress in realising the promise of micro-
arrays in systems neurobiology. Neuron Jan 20, 45(2): 183–185.
Foster RG, Hankins MW (2002) Non-rod, non-cone photoreception in the verte-
brates. Prog Retin Eye Res 21: 507–527.
Freeman WM, Walker SJ, Vrana KE (1999) Quantitative RT-PCR: pitfalls and poten-
tial Biotechniques 26(1): 112–122, 124–125.
Ginzinger DG (2002) Gene quantification using real-time quantitative PCR: an
emerging technology hits the mainstream. Exp Hematol 30(6): 503–512.
Govardovskii VI, Fyhrquist N, Reuter T, Kuzmin DG, Donner K (2000) In search of
the visual pigment template. Vis Neurosci 17: 509–528.
Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis: real-time
monitoring of DNA amplification reactions. Biotechnology (NY). 11(9):
1026–1030.
Higuchi R, Watson R (1999) Kinetic PCR analysis using a CCD camera and without
using oligonucleotide probes. PCR Applications: Protocols for Functional
Genomics. Innis MA, Gelfand DH, Sninsky JJ (edn). Academic Press, San Diego, CA.
Jacobs GH, Neitz J, Deegan JF (1991) Retinal receptors in rodents maximally sensitive
to ultraviolet light. Nature 353: 655–656.
Kainz P (2000) The PCR plateau phase: towards an understanding of its limitations.
Biochimi and Biophys Acta 1494(1–2): 23–27.
Klein D (2002) Quantification using real-time PCR technology: applications and
limitations. Trends Mol Med 8(6): 257–260.
Liu W, Saint DA (2002a) A new quantitative method of real-time RT-PCR assay based
on simulation of PCR kinetics. Analytical Biochemistry. 302(1): 52–59.
Liu W, Saint D (2002b) Validation of a quantitative method for real time PCR
kinetics. Biochemical and Biophysical Research Communications 294: 347–353.
Livak KJ (1997) ABI Prism 7700 Sequence Detection System. User Bulletin #2. PE
Applied Biosystems.
Livak KJ, Schmittgen TW (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2–ΔΔCt method. Methods 25(4): 402–408.
Lucas RJ, Freedman MS, Munoz M, Garcia-Fernandez JM, Foster RG (1999)
Regulation of the mammalian pineal by non-rod, non-cone photoreceptors.
Science 284(5413): 505–507.
Lucas RJ, Douglas RH, Foster RG (2001) Characterization of an ocular photopigment
capable of driving pupillary constriction in mice. Nat Neurosci 4: 621–626.
Nir I, Agarwal N (1993) Diurnal expression of c-fos in the mouse retina. Molecular
Brain Research 19: 47–54.
Ott RL, Longnecker M (2001) An introduction to statistical methods and data analysis.
Duxbury, Pacific Grove, CA.
Peirson SN, Butler JB, Foster RG (2003) Experimental validation of novel and conven-
tional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res
31(14): e73.
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Research 29(9): 2002–2007.
Pritchard CC, Hsu L, Delrow J, Nelson PS (2001) Project normal: Defining normal
variance in mouse gene expression. Proc Natal Acad Sci USA 98(23): 13266–13271.
126 Real-time PCR
Provencio I, Rodriguez IR, Jiang G, Hayes WP, Moreira EF, Rollag MD (2000) A novel
human opsin in the inner retina. J Neurosci 20: 600–605.
Ramakers C, Ruijter JM, Lekanne Deprez RH, Moorman AFM (2003) Assumption-free
analysis of quantitative real-time polymerase chain reaction (PCR) data.
Neuroscience Letters 339: 62–66.
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. Third Edition.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Sekaran S, Foster RG, Lucas RJ, Hankins MW (2003) Calcium imaging reveals a
network of intrinsically light-sensitive inner-retinal neurons. Curr Biol 13:
1290–1298.
Semo M, Lupi D, Peirson SN, Butler JN, Foster RG (2003) Light-induced c-fos in
melanopsin retinal ganglion cells of young and aged rodless/coneless (rd/rd cl)
mice. European Journal of Neuroscience 18: 1–11.
Sturzenbaum SR, Kille P (2001) Control genes in quantitative molecular biological
techniques: the variability of invariance. Comparative Biochemistry and Physiology
Part B 130: 281–289.
Sun H, Macke JP, Nathans J (1997) Mechanisms of spectral tuning in the mouse
green cone pigment. Proc Natal Acad Sci USA 94: 8860–8865.
Tichopad A, Dzidic A, Pfaffl MW (2002) Improving quantitative real-time RT-PCR
reproducibility by boosting primer-linked amplification efficiency. Biotechnology
Letters 24: 2053–2056.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F
(2002) Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. Genome Biol 3(7):
RESEARCH0034 e-Pub.
Walker NJ (2002) Tech.Sight. A technique whose time has come. Science 296(5567):
557–559.
Yoshida K, Kawamura K, Imaki J (1993) Differential expression of c-fos mRNA in rat
retinal cells: regulation by light/dark cycle. Neuron 10: 1049–1054.
Quantitative gene
expression by real-time
PCR: a complete
7
protocol
Thomas D. Schmittgen
7.1 Introduction
Real-time quantitative PCR has been applied for many different biological
applications including identifying genomic DNA copy number, single
nucleotide polymorphism (SNPs), DNA methylation status, viral load and
many others. One of the more popular applications of real-time PCR is to
quantify levels of RNA (Wong et al., 2005). Using this technique, RNA is first
converted to cDNA and then amplified by the PCR. The products of the PCR
are detected in real-time using dedicated instrumentation.
Quantifying gene expression using PCR is one of the more intimidating
techniques of modern molecular biology because of the perception that the
RNA will be degraded and/or inaccurately measured. The advent of real-
time quantitative PCR has greatly simplified gene expression analysis. The
purpose of this protocol is to describe each of the steps that are involved in
measuring gene expression using real-time PCR. These include sample
preparation, isolation of RNA, reverse transcription, primer design, plate
set-up and data analysis. Variations of the protocol are included for both
cell lines and tissues. An emphasis has been placed on various tips and tricks
to increase throughput and reduce error. Implementation of a well-
organized and methodical protocol will produce accurate, precise and
reproducible data no matter what the tissue or gene of interest.
7.2 Materials
7.2.1 Reagents and consumables
Isopropanol
Ethanol
Molecular biology grade water (Sigma Chemical Co.)
Chloroform
Trizol® Reagent (Invitrogen)
Glycogen for molecular biology (Roche)
SYBR® Green PCR master mix (Applied Biosystems)
128 Real-time PCR
RNase-free DNase I (10 U/μl) (Roche)
RNA guard, Porcine (Amersham Pharmacia Biotech)
SuperScript II (200 U/μl) (Invitrogen)
100 mM dNTP set (Invitrogen)
BSA (RNase-free) (Amersham Pharmacia Biotech)
Random primers (Invitrogen)
Optical Adhesive Cover (Applied Biosystems)
96-well real-time PCR plate (Applied Biosystems)
Phase lock gel, 2 ml (Eppendorf)
Aerosol-resistant pipette tips (Rainin)
7.2.2 Equipment
DNA Engine® Thermal Cycler PTC-0200 (MJ Research)
ABI Prism® 7900 HT real-time PCR instrument (Applied Biosystems)
ND-1000 micro spectrophotometer (NanoDrop Technologies)
Allegra 25R centrifuge with microplate adapters (Beckman Coulter)
Stainless steel mortar and pestle sets (Fisher)
L-2, L-20, L-200 and L-1000 Pipettes (Rainin)
L8–10 and L8–200 multichannel pipettes (Rainin)
LTS-200 repeating pipette (Rainin)
7.3 Procedure
7.3.1 Sample preparation
1. Cell lines or blood cells – For attached cells, first trypsinize or scrape
attached cells from the culture flask. Pellet suspension cells by centrifu-
gation. Determine cell number using a hematocytometer and place ~3
× 106 cells into to a labeled, microcentrifuge tube. Centrifuge for 5 min
at 600 × G, aspirate the supernatant and store the tubes at –80°C.
2. Tissues – Place 10 mg of tissue (2 mm3) into a microcentrifuge tube.
Flash freeze the tube by dropping it into a dewer containing liquid
nitrogen and store the tubes at –80°C.
7.3.2 Isolation of RNA from cultured cells or blood
With the exception of step 7, the protocol for isolating RNA is identical to that
described in the Trizol® protocol.
3. Remove cells from the –80°C freezer and place the tubes on dry ice to
prevent thawing.
4. Remove one sample from the dry ice and add 1 ml of Trizol®. It is not
necessary to thaw the cells prior to adding the Trizol®.
5. Lyse the cells using a L-1000 pipettor by repeated pipetting until the
solution is homogeneous. Incubate at room temperature for 5 min.
6. Add 200 μl of chloroform, shake by hand 15 times and incubate at
room temperature for 3 min.
7. Transfer the mixture to a 2 ml Eppendorf phase lock tube. The phase
lock tube will prevent mixing of the organic and aqueous layers.
Quantitative gene expression by real-time PCR: a complete protocol 129
8. Centrifuge the phase lock tube in the cold for 15 min at 12,000 × G.
Remove the supernatant and place into a 1.5 ml colored, microcen-
trifuge tubes. Colored tubes will enhance visualizing the RNA pellet.
9. Add 500 μl of isopropanol and precipitate the RNA for 10 min at room
temperature. This is a good stopping point. If necessary, the samples
may be placed in the −20°C freezer overnight.
10. Place the tubes in a microcentrifuge in the cold (e.g. cold room, refrig-
erated microcentrifuge or microcentrifuge placed in a refrigerated unit).
Orient the caps to the outside of the centrifuge’s rotor. Centrifuge for
10 min at 12,000 × G. The RNA pellet should be visible at the bottom of
the tube on the side that was oriented to the rotor’s outside.
Refer to section on troubleshooting
11. Decant the supernatant into a 2 ml microcentrifuge tube. It is not
necessary to remove all of the supernatant. Add 1,000 μl of 75%
ethanol. Centrifuge for 5 min at 7,500 × g in the cold.
12. Decant the supernatant into the same 2 ml microcentrifuge tube used
for the isopropanol. Briefly spin the tube containing the RNA for several
seconds to bring the residual ethanol to the bottom of the tube.
13. Using a pipette, remove most of the residual ethanol, being careful not
to disturb the pellet. To remove the remaining ethanol, place the tubes
into a dessicator containing a porcelain platform filled with Drierite.
Connect to house vacuum for 5 min. It is not necessary to completely
dry the sample since the residual water will not affect the reverse
transcription step.
14. Dissolve the RNA pellet in 30–50 μl of molecular biology grade water
and place the tubes on ice. RNA may be stored at –80° C, however it is
recommended that RNA be converted to cDNA on the same day of the
isolation.
7.3.3 Isolation of RNA from whole tissue
15. Remove the tissues from the –80°C freezer and place on dry ice.
16. Pre-chill the stainless steel mortar and pestle sets on dry ice. Place the
frozen tissue into the cold mortar. Place the pestle onto the mortar and
pulverize the tissue into a frozen powder by forcefully striking with a 2-
pound hammer.
17. Transfer the frozen, pulverized tissue as quickly as possible into a 1.5
ml microcentrifuge tube that has been pre-chilled on dry ice. Do not
let the pulverized tissue thaw. A sterile disposable surgical blade is ideal
for transferring the powdered tissue. Use one new blade per tissue
sample.
18. Place the tubes containing the pulverized tissue on dry ice until all of
the samples are ready for lysis.
19. Proceed with steps 4–14 to isolate the RNA.
Use the mortar and pestle sets only once per tissue. Clean the mortar and
pestle sets with soap and water, dry and re-chill on dry ice prior to isolating
any additional tissues.
130 Real-time PCR
7.3.4 RNA quantification
The RNA must be quantified to ensure that equal amounts are added to each
reverse transcription reaction.
20. Place 1 μl of undiluted RNA onto the lower measurement pedestal of
the ND-1000 micro spectrophotometer. Lower the sample arm and take
the reading.
21. Wipe off the sample from both the upper and lower pedestals using a
clean Kimwipe. It is not necessary to rinse the instrument with water.
7.3.5 DNase treatment
Briefly treat the RNA with RNase-free DNase to remove any residual genomic
DNA that may be present in the RNA. Prepare the DNase master mix accounting
for 1–2 additional reactions.
Ingredient Per reaction For x reactions
RNase-free DNase I (10 U/μl) 1.8 μl x × 1.8 μl
RNA guard 0.3 μl x × 0.3 μl
25 mM MgCl2 2.4 μl x × 2.4 μl
Total 4.5 μl x × 4.5 μl
22. Add 1.2 μg of RNA, 4.5 μl of master mix and water to 30 μl into 200 μl
PCR strip tubes.
23. Mix by gentle flicking, and briefly spin on a minicentrifuge that can
handle strip tubes. Using a PCR Thermal Cycler, incubate at 37°C for 10
min and then 90°C for 5 min to inactivate the DNase.
7.3.6 cDNA synthesis
Refer to section on troubleshooting
24. Prepare the following master mix, accounting for 1–2 additional
reactions per gene.
Ingredient Per reaction For x reactions
5X SuperScript II buffer 10 μl x × 10 μl
10 mM dNTPs 5 μl x × 5 μl
0.1 M DTT 5 μl x × 5 μl
BSA (RNase-free, optional) 1.25 μl x × 1.25 μl
Random primers 0.25 μl x × 0.25 μl
RNA guard 1.25 μl x × 1.25 μl
Superscript II reverse transcriptase 1.25 μl x × 1.25 μl
Molecular biology water 1 μl x × 1 μl
Total 25 μl x × 25 μl
25. Using the LTS-200 repeating pipette, add 25 μl of the reverse transcrip-
tion master mix to 200 μl PCR strip tubes labeled with the date and
sample number on the side.
26. Add 25 μl of the DNase-treated RNA to each tube. This will contain 1 μg
of RNA.
Quantitative gene expression by real-time PCR: a complete protocol 131
27. Incubate at the following temperatures using a PCR thermal cycler:
26°C for 10 min (to allow the random hexamers to anneal), 42°C for 45
min (reverse transcription) and 75°C for 10 min (to inactivate the
reverse transcriptase).
28. The resulting cDNA may be analyzed immediately by real-time PCR or
stored at –20°C or –80°C.
7.3.7 SYBR® Green
SYBR® Green is a minor groove binding dye that binds double-stranded (ds)
DNA but not single stranded DNA. A signal from SYBR® Green will be
detectable only after significant amplification (>15 cycles for most cDNA).
Since SYBR® Green binds to dsDNA, all dsDNA present in the reactions (e.g.
primer dimers or non-specific amplification products) will also be detected.
Primers should always be validated to insure that a single amplicon is gener-
ated by the PCR. Reactions may be run on agarose gels to ensure that only
one product is present. The thermal denaturation protocol on the Applied
Biosystems and most other real-time PCR instruments should always be run
following SYBR® Green reactions. This heats the products after the final
reaction from 60°C to 90°C and will produce a characteristic peak at the Tm
of each amplicon. If only one amplicon is present, then only one peak will
be present. If primer dimers are present along with the product then a
second peak (usually with reduced Tm) will be seen.
7.3.8 Primer design
Use a computer program such as Primer Express® (Applied Biosystems) or
equivalent to design primers. Alternatively already designed primers in
several open access databases may be used (see Chapter 5). For analysis of
cDNA from messenger RNA, design PCR primers to span one intron. Should
any genomic DNA be present following the DNase treatment, the thermal
denaturation protocol will detect two different PCR products, the shorter
cDNA and the much longer genomic DNA. A convenient method to deter-
mine where the intron/exon junctions exist in a cDNA sequence is to BLAST
the cDNA sequence of your gene of interest against the genomic sequence
for the same gene. The BLAST report will locate the sequence of the
intron/exon junctions. Adhere to the rules of primer design listed in Table
7.1. Dissolve primers in molecular biology grade water and store at –20°C.
Table 7.1 Design criteria for real-time PCR primers, SYBR® Green detection
Primer length 18–24 nt
Amplicon length <250 bp (ideally <150 bp)
Both sense and anti-sense primers should have a Tm ≤2°C of each other
Primer Tm 50–60°C (ideal range 55–59°C)
No consecutive runs of the same nucleotide more than six times
No runs of more than three consecutive Gs
% GC content of primers ~50% (no less than 35% and no more than 65%)
No 3’ GC clamp on primers (i.e. GG, CC, CG or GC)
≤2 GC in the last five nucleotides of the 3’ end of the primer
See also Chapter 5 for more considerations on primer design.
132 Real-time PCR
Figure 7.1
An example of a PCR set-up sheet. The numbers (1 to 6) represent different
samples of cDNA. The numbers on the top of the columns (e.g. 313/232)
represent the pair of primers.
Working stock solutions of primers are diluted to 50–100 μM and stored at
–20°C.
7.3.9 Real-time PCR
Perform triplicate PCRs per gene, per cDNA sample. Most real-time PCR instru-
ments are configured with a 96-well block. Use a ‘PCR set-up sheet’ (Figure 7.1)
to organize the pipetting of the plate as well as to coordinate the data during the
analysis.
29. Prepare the following master mix, accounting for 1–2 additional
reactions per gene:
Ingredient Per reaction For x reactions
2X SYBR® Green reagent 12.5 μl x × 12.5 μl
Forward/Reverse primer mix 0.125 μl x × 0.125 μl
(50 μM each)
Molecular biology grade water 7.375 μl x × 7.375 μl
Quantitative gene expression by real-time PCR: a complete protocol 133
30. Dilute the cDNA 1:50 or 1:100 by first placing molecular biology grade
water into a disposable sterile basin. Add 99 μl of the water into the PCR
strip tube using a multichannel pipette.
31. Add 1 μl of cDNA to the labeled strip tubes using a multichannel pipette
(e.g. Rainin L8–10). Use a multichannel pipette (e.g. Rainin L8–200) to
mix the solution 20 times. For efficient mixing, set the pipette at 75%
of the solution’s volume (75 μl in this example).
Refer to section on critical steps
32. Recap the undiluted cDNA with new strip caps to prevent cross conta-
mination.
33. Use a fine tip marker to mark the plate to the location of the different
master mixes similar to the set-up sheet in Figure 7.1.
34. Use the repeating pipette (Rainin, E12–20) to add 20 μl of master mix to
each sample. Add one row at a time.
35. Add 5 μl of dilute cDNA to each of the wells using a multichannel
pipette.
36. Add the optical adhesive cover and seal using the sealing tool. Perform
a brief spin (up to 1500 RPM) on a centrifuge equipped with a 96 well
plate adapter.
37. Perform PCR using the real-time instrument per the manufacturers’
protocol. Typically, 40 cycles of 15 sec at 95°C and 60 sec at 60°C
followed by the thermal dissociation protocol.
7.3.10 Data analysis
There are two common methods of analyzing gene expression data gener-
ated by real-time PCR; absolute quantification and relative quantification
(see also Chapters 2, 3, and 6). For routine gene expression analysis, it is not
necessary to know precise copy number and the relative changes in expres-
sion will suffice. For example, it is not important that a drug increased the
copy of gene x from 10,000 to 50,000 copies per cell, only that the change
in expression was increased by five-fold. For this reason, only an example of
the relative quantification method will be given here. The most commonly
used method for relative quantification is the 2–ΔΔCt method. Derivation and
examples of this method have been described elsewhere (Livak et al., 2001).
Calculate the relative difference in gene expression using the 2–ΔΔCt
method.
Relative fold change in gene expression = 2–ΔΔCt
Where: ΔΔCt = ΔCt treated – ΔCt untreated
and ΔCt = (Ct target gene – Ct reference gene)
Refer to section on critical steps
38. The reference gene should be properly validated. Selection of the refer-
ence or internal control gene is critical as the expression of the reference
gene will often fluctuate with treatment or disease. While the user is
welcome to try commonly used internal controls (e.g. β-Actin, GAPDH,
or β-2 microglobulin), in our experience, highly expressed, non-protein
coding genes, such as 18S rRNA or U6 RNA, have performed the most
consistently for most applications. Primer sequences have been
134 Real-time PCR
30
28 䊏
26
24 䊏
22
Ct
䊏
20
18
䊏
16
y = –3.513x + 37.85 䊏
14 r < = 0.9956
12
0 1 2 3 4 5 6
log cDNA dilution
Figure 7.2
An example of the plot used in amplification efficiency calculation.
published for 18S rRNA (Schmittgen et al., 2000) and U6 RNA
(Schmittgen et al., 2004). It may be the best strategy to use multiple refer-
ence genes as described elsewhere in this book (Chapters 4, 6, and 8).
Refer to section on critical steps
39. Determine the amplification efficiency of the reaction for both the
target and reference genes (Figure 7.2 and see below). The 2–ΔΔCt method
assumes that the amplification efficiency for both the target and refer-
ence genes is similar (Livak et al., 2001).
Calculation of fold-change in gene expression
40. Export the raw Ct values from the real-time PCR analysis into Microsoft
Excel®. Assign sample number, gene name and treatment to each data set.
41. Sort the data such that it groups the sample number (in triplicate), treat-
ment and gene. Calculate the mean Ct value for the internal control gene.
42. Enter the mean Ct for the internal control into one column of the
spreadsheet and write a macro to calculate the 2–ΔΔCt. A sample spread-
sheet is presented (Figure 7.3).
43. Calculate the mean fold change, standard deviation and coefficient of
variation for the triplicate PCRs for each sample. Acceptable coefficient
of variation for triplicate PCRs from the identical sample of dilute cDNA
is 2–30%.
Refer to section on troubleshooting
Quantitative gene expression by real-time PCR: a complete protocol 135
Mean Fold Change
- CT
Sample # Well Type Gene Time (h) Primer/Probe CT Time X Mean CT Time 0 2 in gene expression S.D. C.V.
1 A1 UNKN fos-glo-myc 0 PR1 22.3 21.9 1.023
2 B1 UNKN fos-glo-myc 0 PR1 22.0 21.9 0.786 1.02 0.228 22.4
3 C1 UNKN fos-glo-myc 0 PR1 21.5 21.9 1.243
4 D1 UNKN fos-glo-myc 0.5 PR1 19.8 21.9 1.845
5 E1 UNKN fos-glo-myc 0.5 PR1 20.2 21.9 2.019 2.00 0.152 7.61
6 F1 UNKN fos-glo-myc 0.5 PR1 20.0 21.9 2.149 2^-((20.0-21.7)-(21.9-22.5))
7 G1 UNKN fos-glo-myc 1 PR1 19.5 21.9 2.271
8 H1 UNKN fos-glo-myc 1 PR1 18.9 21.9 3.466 2.86 0.598 20.9
9 A2 UNKN fos-glo-myc 1 PR1 19.2 21.9 2.855
. . . . . . . . . . .
. . . . . . . . . . .
. . . . . . . . . . .
1 A5 UNKN Beta Actin 0 PR2 22.9 22.5
2 B5 UNKN Beta Actin 0 PR2 22.3 22.5
3 C5 UNKN Beta Actin 0 PR2 22.4 22.5
4 D5 UNKN Beta Actin 0.5 PR2 21.2 22.5
5 E5 UNKN Beta Actin 0.5 PR2 21.7 22.5
6 F5 UNKN Beta Actin 0.5 PR2 21.7 22.5
7 G5 UNKN Beta Actin 1 PR2 21.2 22.5
8 H5 UNKN Beta Actin 1 PR2 21.2 22.5
9 A6 UNKN Beta Actin 1 PR2 21.3 22.5
Figure 7.3
A sample spreadsheet showing the calculation of relative quantification by the
2–ΔΔCt method. (Reproduced by permission of Elsevier.)
7.4 Troubleshooting
Problem Solution
RNA pellet is not visible after Add 2 μl of glycogen (1 mg/ml) to
initial precipitation step. the isopropanol/RNA mixture and
precipitate overnight at –20°C.
RNA pellet is still not visible Inefficient lysis of sample (step 5).
following the addition of glycogen Lyse cells using a 1 cc disposable
and overnight precipitation. syringe and 23 gauge needle. Also
possible that cells/tissue have low
amount of RNA. Increase the amount
of cells or tissue (steps 1 and 2).
RNA is very GC-rich or contains Synthesize cDNA using a
high amount of secondary structure. thermostable reverse transcriptase
(e.g. Thermoscript, Invitrogen) and
increased reaction temperature. Use
gene specific primers instead of
random primers since random
primers will not anneal at elevated
temperatures.
Primer pair produces PCR Optimize the MgCl2 and/or primer
efficiency <1.85. concentration in the PCR to increase
the efficiency.
High variation (>60%) among Check pipetting technique and
triplicate PCRs from the identical pipettes. Use newer and recently
sample of diluted cDNA. calibrated/serviced pipettes. Check
the wells in the 96-well plate to see
if evaporation has occurred
following the PCR.
136 Real-time PCR
7.5 Critical steps
Step 31 Dilution and pipetting of cDNA are the most critical steps in the
analysis and will introduce the greatest amount of error if done incorrectly.
Always make fresh dilutions of cDNA on the day of the analysis and discard
any diluted cDNA that remains. Do not freeze and reanalyze the diluted
cDNA. Always dilute 50% more cDNA than you think you will need for that
day. The original, undiluted cDNA is very stable and may be re-used for
many years if stored properly.
Step 35 Apply the technique of ‘pipette overloading’ to deliver the correct
amount of cDNA and reduce the aspiration and adhering of sample to the
pipette tip. Depress the plunger of the multichannel pipette set for 5 μl
until it stops, then depress the plunger a little bit further. Place the pipette
into the PCR strip tubes containing the dilute cDNA and pick up the
sample. Add the 5 μl sample to the side of the PCR plate by depressing the
plunger until it stops. This will leave some residual solution in each tip.
Discard the tips and repeat using new tips.
Step 38 Proper validation of the internal control gene is critical. The inter-
nal control gene should not change under experimental conditions (e.g.
treated versus untreated or normal versus diseased tissue). Validation of the
internal control should be done prior to quantifying the gene(s) of interest.
Methodology to validate internal control genes has been described previ-
ously (Schmittgen et al., 2000). In brief, triplicate PCRs should be performed
on each sample of cDNA (both treated and untreated samples) using
primers for the internal control gene. Calculate the mean Ct for each cDNA
and present the expression of the internal control as 2–Ct. Perform statistical
analyses as described (Schmittgen et al., 2000) or use the students t-test to
determine if the internal control gene has fluctuated under the conditions
of the experiment.
Step 39 PCR efficiency is determined from the equation N = N0 × En, where
N is the number of amplified molecules, N0 is the initial number of
molecules, n is the number of PCR cycles and E is the efficiency which is
ideally 2 (Mygind et al., 2002). When the equation is of the form n = –(1/log
E) × log N0 + (log N/log E), a plot of log copy number versus Ct yields a
straight line with a slope = –(1/log E) (Figure 2). Acceptable amplification
efficiencies using this method are 1.85 to 2.05. Determination of amplifica-
tion efficiency using this method has been described previously
(Schmittgen et al., 2004).
7.6 Comments
It is important to remember that RNA will be degraded only in the presence
of ribonuclease. Ribonuclease may be present in the lab from previous
experiments (e.g. RNAse protection assays), from glassware that once
contained serum or from human skin. The likelihood of ribonuclease conta-
mination may be alleviated by performing experiments with RNase in
dedicated spaces or in separate laboratories, by using disposable plasticware
rather than reusable glassware and by always wearing clean gloves when
Quantitative gene expression by real-time PCR: a complete protocol 137
working with RNA. The two most important aspects of this procedure are to
have a visible RNA pellet after the initial precipitation step and accurate
pipetting. Due to the sensitivity of the PCR, it is possible to obtain PCR
signals by amplifying cDNA synthesized from <1 ng of total RNA. However,
we have observed the most consistent results when an RNA pellet is visible
following the precipitation. Accurate and conscientious pipetting is critical
to reducing error and preventing cross contamination.
References
Livak KJ, Schmittgen TD. (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:
402–408.
Mygind T, Birkelund S, Birkebaek N, Oestergaard L, Jensen J, Christiansen G (2002)
Determination of PCR efficiency in chelex-100 purified clinical samples and
comparison of real-time quantitative PCR and conventional PCR for detection
of Chlamydia pneumoniae. BMC Microbiol 2: 17.
Schmittgen TD, Jiang J, Liu Q, Yang L (2004) A high-throughput method to monitor
the expression of microRNA precursors. Nucleic Acids Res 32: E43.
Schmittgen TD, Zakrajsek BA (2000) Effect of experimental treatment on house-
keeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem
Biophys Methods 46: 69–81.
Wong ML, Medrano JF (2005) Real-time PCR for mRNA quantitation. Biotechniques
39: 75–85.
Real-time PCR using
SYBR® Green
Frederique Ponchel
8
8.1 Introduction
Real-time PCR has become a well-established procedure for quantifying
levels of gene expression, as well as gene rearrangements, amplifications,
deletions or point mutations. Its power resides in the ability to detect the
amount of PCR product (amplicon) at every cycle of the PCR, using fluores-
cence. Several approaches have been employed to detect PCR products. The
most popular ones are based on specific binding of hydrolysis of hybridiza-
tion probes to the target sequence. Another approach uses fluorescent dyes,
which bind to the double-stranded PCR product non-specifically. Although
both assays are potentially rapid and sensitive, their principles of detection
and optimization are different, as is the resulting cost per assay. Here we will
explore the development and rigorous testing of a real-time PCR assay using
the inexpensive SYBR® Green I technology.
8.2 SYBR® Green chemistry
SYBR® Green is a fluorescent dye that binds only to double-stranded DNA.
Fluorescence is emitted proportionally to the amount of double-stranded
DNA. In a PCR reaction, the input DNA or cDNA is minimal and, therefore,
the only double stranded DNA present in sufficient amounts to be detected
is the PCR product itself. As for other real-time PCR chemistries, read-outs
are given as the number of PCR cycles (‘cycle threshold’ Ct) necessary to
achieve a given level of fluorescence. During the initial PCR cycles, the
fluorescence signal emitted by SYBR® Green I bound to the PCR products is
usually too weak to register above background. During the exponential
phase of the PCR, the fluorescence doubles at each cycle. A precise fluores-
cence doubling at each cycle is an important indicator of a well optimized
assay. After 30 to 35 cycles, the intensity of the fluorescent signal usually
begins to plateau, indicating that the PCR has reached saturation. As Ct
correlates to the initial amount of target in a sample, the relative concen-
tration of one target with respect to another is reflected in the difference in
cycle number (ΔCt = Ctsample – Ctreference) necessary to achieve the same level of
fluorescence.
There are now many commercially available SYBR® Green chemistry kits
(SYBR® Green core reagents master mix by ABI; QuantiTech SYBR® Green
140 Real-time PCR
PCR master mix by Qiagen; DNA master SYBR® Green by Roche; IQ™ SYBR®
Green supermix by Biorad; Superarray by BioScience Corp.; DyNAsin™ II
DNA polymerase with SYBR® Green by MJ Research and probably others).
There is no clear indication for choosing one over the others, however, once
an assay has been optimized with one chemistry, changing kit requires re-
optimization. Prices differ and may guide towards one kit or another
depending on amount of usage. To minimize variability, assays using
master mixes may be recommended, although multi-user facilities may
prefer individual reagents. It is also possible to use homemade SYBR® Green
master mixes to reduce cost even further (Karsai et al., 2002).
8.3 Primer design
Optimal design of the PCR primers is essential for accurate and specific
quantification using real-time PCR. For the assay described herein, detec-
tion is based on the binding of the SYBR® Green I dye into double-stranded
PCR products, which is a sequence-independent process. While this assay is
cheaper than the specific probe-based assays, it loses the additional level of
specificity introduced by the hybridization of a specific fluorescent
TaqMan® probe to the PCR product. The sensitivity of detection with SYBR®
Green may therefore be compromised by the lack of specificity of the
primers, primer concentration (which can be limiting) and the formation of
secondary structures in the PCR product. The formation of primer-dimers
may register false positive fluorescence, however, this can now easily be
overcome by running a PCR melting curve analysis. The 5’ nuclease assay
using TaqMan® probes would also be compromised by the lack of primer
specificity and limiting primer concentration, and although these are not
detected by the TaqMan® probe, they alter the amplification efficiency of
the PCR reaction.
Primer design for SYBR® Green based assays needs to be more stringent
than for a classic TaqMan® assay. It largely depends on the sequence
targeted, and varies with the type of assay required: gene amplification,
rearrangement, deletion, cDNA quantification, splicing variant and others.
Primer design is still very restrictive: the annealing temperature is limited to
between 58 and 60°C, which correspond to the optimal working conditions
for the Taq DNA polymerase enzyme, and the length of the PCR product
has to be set between 80 and 150 bp. The use of software dedicated to real-
time PCR primer design, such as Primer Express® (Applied Biosystems), is
highly recommended. However, it has rarely proven efficient using the
TaqMan® primer/probe design option and is rather more successful using
the simple DNA PCR option.
The first step in primer design is to determine the sequence that needs to
be targeted by the PCR. This is highly dependent on the type of assay (gene
amplification, rearrangement, deletion, gene expression, splicing variant,
promoter switch, chromatin immunoprecipitation or others), which
restricts the sequence available to design primers. The second step is to
identify related genes and eliminate regions of high homology, which may
further restrict the length of the sequence available. A third step in primer
design for cDNA quantification requires the design to overlap exon–exon
boundaries.
Real-time PCR using SYBR® Green 141
8.3.1 Step by step primer design: b-actin for a cDNA
quantification assay
Identify the target sequence
Browse the human genome project database with β-actin as the keyword to
identify the sequence, chromosome location (7p22.1), mRNA accession
number (X00351), mRNA length (1761 bp) and gene structure (5 exons).
To choose a suitable accession number to base primer design on, use the
graphic representation to select an mRNA that includes all the exons and
has 5’ and 3’ sequence (the database is full of all sorts of partial cDNA
sequences (e.g. CR685511) and mRNA with ‘alternative’ or ‘inconsistent’
exons (e.g. AK097861)).
Restrict this sequence with regards to regions of homology with
related genes (α-actin, γ1 and γ2-actin)
Align these sequences to determine domain of homology. Use the align-
ment tools on the NCBI website (BLAST 2 sequences) to find homologies.
Determine exon-exon boundaries
Use the human genome browser, click on the accession number for the
human mRNA corresponding to the full-length transcript (e.g. X00351).
Click on the accession number at the top to display the sequence database
information. Click on the accession number under ‘query’ in the
mRNA/Genomic alignment section to obtain 5’ and 3’ sequences (red),
coding region (blue), ATG and STOP codons (underlined), exon–exon
boundaries (bold, light blue or orange). Avoid inconsistent splicing sites
and polyadenylation signals (underlined but not always).
Design primers
As a result of this preliminary work, the sequence available for designing
primer to quantify the expression of β-actin is restricted to two regions,
between nucleotides 1 and 90 or between nucleotides 1208 and 1763. There
is no exon boundary in the second region. The design should, therefore, be
limited to the region between the first and second exons of the gene.
Transfer this sequence to the primer design software (e.g. Primer Express®
from ABI) and proceed to design.
Copy the mRNA sequence into a simple PCR document. Restrict the
target sequence accordingly. Select the option for primer Tm (59°C) and
amplicon length (80 to 120). Keep the CG content at default settings and
primer length below 24 bp.
See if the software comes up with a possible primer pair. If not, use the
primer test document and try to select sections of sequence manually. This
sequence is very CG rich, therefore, select a region with A or T as 3’ for each
primer. Elongate the primer in 5’ until reaching a Tm between 58° and 60°C.
Lastly, BLAST the primers (limit to the human species and mRNA bank).
If the restriction in the target position has been done thoroughly, the
BLAST search should give no matches. Quite a lot of hits are nevertheless
142 Real-time PCR
reported for these primers. Most of them are on anti-sense strands of
cDNAs. If none of them comes in both the forward and the reverse primer
BLAST searches, no PCR product can be generated from these hits.
These primers are located in the 5’ of the mRNA. This is an issue if the
quality of the RNA is not sufficient to ensure reverse transcription up to the
5’ end of the mRNA when an oligo-dT cDNA synthesis method is used.
Therefore, a random hexamer cDNA synthesis is recommended when using
these primers for β-actin as a housekeeping gene.
8.4 Primer optimization
The optimization of the primer concentration is essential. Each set of
primers works best at a different concentration. Primer concentration is
usually determined to be optimal when the specific amplification relative to
primer-dimers is maximal, in a positive versus negative control experiment.
However, the recent development of melting curve analysis for PCR
products has made the dimers issue obsolete (see below and also the next
chapter). One major limitation in primer optimization is, however, the
availability of a good positive template for optimization. Finding a tissue
that definitely expresses the gene of interest, cloning a rearrangement or a
translocation, etc, remain essential to the optimization process. Again
primer optimization differs from one type of assay to another.
8.4.1 Absolute quantification of gene expression
This is an easy procedure of primer concentration optimization, where one
is looking for the best possible conditions of amplification (lowest Ct ). The
procedure consists of varying the amounts of primer added to the reaction,
in order to find the most efficient concentration, bearing in mind that
‘more’ does not always mean ‘better’. There should be no difference in the
other reagents used per reaction and the same input target cDNA should be
used in all PCR reactions. For easy pipetting (for a 25 μl reaction), con-
centrations of 50, 100, 300, 500, and 1,000 nM can be used. An optimiza-
tion matrix can be set up as shown below. Routinely, a simpler matrix (grey
boxes) can be used to find good conditions and then further refined if
necessary. An excess of primer, such as 1,000 F/1,000 R nM (as in the above
examples) is often limiting and decreases the efficiency of the PCR reaction.
An example of this procedure is illustrated in Figures 8.1A and 8.1B.
Following primer concentration optimization, a standard curve should be
done, to perform an absolute quantification, but also to find the limits of
sensitivity of the assay. A serial dilution of a factor 10 is easy to use and
provides an obvious difference of Ct between points. A positive target
sample should be used, which either contains a known amount of the target
or is used as a default value of 1 (Figures 8.2 and 8.3).
8.4.2 Relative quantification of gene expression
This is also an easy optimization procedure, but one is looking for the best
possible conditions of amplification (lowest Ct) with a similar PCR
efficiency for both the target and the endogenous control(s) as reference
Real-time PCR using SYBR® Green 143
Forward primer (nM)
Reverse primer 50 100 300 500 1000
(nM)
50 50/50 50/100 50/300 50/500 50/1000
100 100/50 100/100 100/300 100/500 100/1000
300 300/50 300/100 300/300 300/500 300/1000
500 500/50 500/100 500/300 500/500 500/1000
1000 1000/50 1000/100 1000/300 1000/500 1000/1000
Figure 8.1A
A standard protocol for optimizing primer concentrations.
40
35
Ct
30
25
20
50/50 100/100 300/300 500/500 1000/1000
Primer concentration (nM)
Figure 8.1B
Two sets of primers were designed to amplify genes grey and black. Primers for
gene grey worked better at 300/300 nM (Ct 28), but those for gene black were
better at 500/500 nM (Ct 25).
(usually several housekeeping genes). The procedure consists of finding the
most efficient primer concentration for both genes (see above), followed by
a comparison of efficiency between target and reference. The same
optimization matrix can be set up to find appropriate primer concentration
conditions (both for the target and the reference genes). Then, a serial
dilution of the input cDNA is used to compare the efficiency of both PCR
reactions in parallel. Ct values will be different between the target and the
reference but one is looking for parallelism between the two standard
curves. PCR efficiencies can be compared by relating the slope of the linear
curve of Ct values plotted against the log-dilution. A perfect reaction has a
slope of 3.3, which corresponds to an exact two-fold amplification at every
cycle of the PCR between dilutions of a factor 10. An example of efficiency
determination is shown in Figure 8.4.
144 Real-time PCR
100 10–1 10–2 10–3 10–4 10–5
Fluorescence
5 10 15 20 25 30 35 40
Cycle number
Figure 8.2
An example of amplification plot.
10–6
10–5
10–4
10–3
Ct
10–2
10–1
100
Log dilution
Figure 8.3
An example of standard curve.
Real-time PCR using SYBR® Green 145
40 䊉
䊏 䊏
䊏
䊉
䉬 䊏
䉱 䉬 䊉 䊏
30
䉱 䉬 䊉 䊏
Ct
䉱 䉬 䊉 䊏
20 䉱 䉬 䊉
䉱 䉬 䊉
䉱 䉬
䉱
10
–7 –6 –5 –4 –3 –2 –1 0 1
Log dilution
Figure 8.4
Standard curves for different target sequences for comparative efficiency
determination. Ideally they should be parallel (same slope) to be assayed
together. The same serial dilution (from pure cDNA to 1/1,000,000) was used
to analyze the efficiency of PCR reaction for genes square, diamond and circle
against the housekeeping gene GAPDH (triangle). The efficiency for GAPDH was
3.20. It was equivalent to the efficiency of the PCR reaction for gene circle, 3.21.
However, the PCR efficiency for gene square was good (3.19 for the first 4 serial
dilutions); the PCR reaction reached its limit after the fourth dilution in a 40
cycles reaction. Finally, the efficiency of the PCR reaction for gene diamond was
3.78. This is too far apart for use in a relative quantification. A new set of
primers should be designed for gene diamond.
8.4.3 Relative quantification of different gene modifications
(amplification, deletion, rearrangement, translocation)
The choice of the most appropriate conditions for these types of assay corre-
sponds to the combination of primer concentration allowing a ratio of 1
between the target gene and the reference gene in a DNA sample with no
genetic abnormality. This ratio is calculated using the ΔCt method (ΔCt = Ct
of target – Ct of reference = 0), a ΔCt of 0 indicating a ratio of 1. A number
of factors can influence this assay, and the optimization consists of
compensating these factors to obtain a ratio of 1 in a DNA sample with no
genetic abnormality. The inclusion of normal DNA sample in each experi-
ment also provides a reference sample for a ΔΔCt method of calculation. As
the normalization will relate to a value close to 0 for the second ΔCt, both
methods essentially give the same result. For an accurate quantification it is
also necessary to verify that PCR efficiency is independent of the initial
amount of target DNA. Each pair of primers therefore needs to be tested
across several log dilution of a control DNA sample as described above.
146 Real-time PCR
Fluorescence (arbitrary unit) Primer-
dimer
+
–
78.5 87.5
65 70 75 80 85 90 95
Melting temperature (°C)
Figure 8.5
An illustration of the use of melting curve analysis to distinguish between
specific and non-specific PCR products (see text).
8.5 Melting curve analysis
Heat dissociation (PCR product melting curve) analysis at the end of the
PCR confirms whether or not a single product is amplified and that no
dimers interfere with the reaction. A melting curve analysis begins with
heating the PCR product at the end of the PCR reaction. As the PCR product
melts and the SYBR® Green is released into the solution, its fluorescence
intensity decreases. A negative first derivation curve of the fluorescence
intensity curve over temperature produced by the instrument’s software
clearly indicates the Tm of the PCR product (peak of the –dF/dT curve) and
should be quite close to the predicted Tm of the PCR product.
In the example illustrated in Figure 8.5, the PCR product Tm is 87.5°C
(curves indicated by +). Complete absence of primer-dimer is rarely
achieved in the PCR negative control (curve indicated by –). As seen in this
example, 1 out of 3 negative triplicates shows dimers (with a Tm of 78.5°C).
The two sets of curves are usually clearly separated with a 10°C shift
between Tm of primer-dimers and the specific PCR product. In an experi-
mental negative including a template but no target, dimmers are not
usually observed. The degree of an eventual primer-dimer contribution to
the overall fluorescent signal of the PCR negative control can also be
detected in such a dissociation analysis. Further details of the use of melting
curve analysis for allelic discrimination are given in Chapter 9.
8.6 Quantification of gene modification
The detection and quantification of gene rearrangement, amplification,
translocation or deletion is a significant challenge, both in research and in
Real-time PCR using SYBR® Green 147
a clinical diagnostic setting. Real-time PCR has become a well-established
procedure for quantifying these gene modifications. For example, the major
and minor break-points of the chromosome 14 to 18 translocation
t(14:18)(q32;q21) have been analyzed in non-Hodgkin’s lymphoma using a
5’ nuclease assay with TaqMan® probes (Estalilla et al., 2000). The diagnosis
and treatment of a number of severe conditions, such as the multi-drug
resistance phenotype in tumors, could benefit from the development of a
quick assay. Compared to Southern blotting or fluorescence in-situ
hybridization (FISH) used for the detection of gene amplification, a SYBR®
Green real-time PCR assay provides a rapid and accurate alternative.
Furthermore, a FISH-based assay would require biologic material, which
may not be available or easy to obtain. Genetic counseling could also
benefit from a quick and reliable assay to determine carriers of tumor
suppressor gene deletions involved in inherited susceptibility to cancer (e.g.
P53, RB, WT1, APC, VHL or BRCA1). The general applicability of a SYBR®
Green real-time PCR assay quantifying such genetic events (deletion, ampli-
fication and rearrangement) has been demonstrated (Ponchel et al., 2003)
and requires inclusion of a number of controls.
8.6.1 DNA quantification
A major aim in using real-time PCR is to allow accurate quantification of
gene modifications in DNA extracted from relatively few cells. For this
purpose, the number of cells present in a given sample can be estimated
using real-time PCR quantification of the copy number of a ‘reference’ gene,
each cell having two allelic copies of this gene. In principle, any gene is
suitable but examination of deletions, amplifications and rearrangements
requires this ‘reference’ gene not to be involved in any of these processes.
The genetic abnormality is then quantified relative to this reference.
It is necessary to establish the validity of the relationship between the
amount of DNA in the sample and the ‘reference’ Ct reading. The relation-
ship between the number of cells in a sample and the DNA concentration of
the sample also needs to be linear, indicating a similar efficiency of the DNA
extraction method irrespective of the initial number of cells in the sample.
Archived material such as paraffin embedded tissue sections can be used.
DNA can be extracted from such material using a simple proteinase K and
phenol extraction methodology, with no need for de-waxing, and used in a
SYBR® Green I real-time DNA quantification assay.
8.6.2 Gene amplification
Detection of gene amplifications, usually in tumor samples, can also be
achieved by SYBR® Green method. In our own experiments, we were able to
obtain results that were in agreement with FISH result (Figure 8.6).
8.6.3 Gene deletion
Our laboratory has successfully used SYBR® Green detection method to
diagnose gene deletions. Point mutations and small insertions or deletions
in the OPA1 gene have been shown to underlie more than half of all cases
148 Real-time PCR
1000
100
Fold amplification
10
1
0.1
PBMC 4699 4801 4813 4818 4695 4334 4819 4306 4777
MYCN
Figure 8.6
MCYN gene amplification in neuroblastoma tumors. We applied a SYBR® Green
1 gene amplification assay to tumor samples for the detection of MYCN. These
samples had been tested previously by standard procedures for the diagnosis of
neuroblastoma using FISH (De Preter et al., 2002). Our results (black bars)
compared well with the established amplification factor recorded for these
tumors (grey bars) and confirmed the presence of MYCN amplification (Ponchel
et al., 2003).
of dominant optic atrophy. In addition, two larger deletions in OPA1 have
been detected, each in a single family. One of these deletes exon 20 and the
surrounding intronic DNA (Alexander et al., 2000), while the other deletes
the entire gene and over half a megabase of surrounding DNA (Marchbank
et al., 2002). We designed a SYBR® Green I assay to quantify the number of
copies of OPA1 exon 20 present in any given sample, which should there-
fore detect both of these deletions. We tested this on genomic DNA from
patients and healthy members of the family and were able to confirm a
reduction in relative copy number in these patients with the deletion of the
entire gene, compared to healthy members of the family (Ponchel et al.,
2003).
8.6.4 Gene rearrangement
A variety of gene arrangements can be detected using dsDNA binding dyes.
Our laboratory has some experience in the detection of T-cell receptor
(TCR) genes. During their passage through the thymus, T-cell precursors
rearrange their TCR genes. This step requires the excision of segments of
DNA, the ends of which are subsequently ligated to form small circles of
Real-time PCR using SYBR® Green 149
episomal DNA (signal and coding) referred to as T-cell receptor excision
circles (TREC). The sequences remaining after recombination provide the
target for the PCR detection of TREC. The point of recombination in TREC
dictates the position of the primers on either side. The sequence around
these allows the primers to be designed with more or less flexibility within
the Tm and amplicon length limits (Ponchel et al., 2003). Similar examples
include Immunoglobulin gene rearrangements, translocations (chromo-
some 14/18 translocation t (14:18) (q32;q21)).
8.6.5 Gene copy number
A SYBR® Green DNA quantification assay could be used for the quantifica-
tion of gene copy number in a transgenic mouse model. The gene Hop was
5’ FLAG-tagged. The endogenous Hop sequences were used as reference
gene for the quantification and the FLAG sequence used to determine the
number of gene copies in individual transgenic mice. We were able to
identify founders carrying either 1 or 2 copies of the transgene (Ponchel et
al., 2003).
8.7 RNA quantification
8.7.1 RNA extraction
There are many methods of RNA extraction available, both manual and
commercial. The choice of method needs to be guided by the nature of the
initial material, biopsy, tissue culture sample, high or low cell number yield,
etc. Commercially available kits perform well enough, have the advantage of
not requiring phenol extraction (with the exception of Trizol®, Invitrogen
Life Technologies) but are costly. They do provide an advantage when low
RNA yield is expected. However, when samples coming from tissue culture,
where experiments are repeatable, manual extractions are better justified.
An important point is to verify the absence of genomic DNA contamina-
tion. A DNase treatment step may be included to follow RNA extraction as
gDNA contamination may interfere with the assay. Different methods and
kits are available. None is particularly better, but a column-based technique
may be easier for inexperienced users.
8.7.2 cDNA preparation
Synthesis of cDNA from mRNA is the first step of RT-PCR gene expression
quantification. The quality of the cDNA is directly related to the quality of
the RNA template. If possible, determine the RNA concentration of samples
before using them in an RT reaction. Again, there are many methods for
cDNA synthesis. Different RT enzyme kits are available (MultyScribe from
ABI, SuperScript II from Invitrogen, AMVRT from Promega, Expand RT from
Roche, and many others) using initiation with either oligo-dT or random
hexamer priming. Random hexamers are preferred for analysis of non poly-
adenylated RNA. Once prepared, first-strand cDNA should not be thawed
and refrozen more than once. During PCR set-up, it has to be kept on ice
and used immediately.
150 Real-time PCR
Once the cDNA has been synthesized, it remains to be verified that no
DNA contaminates the samples. As the assay to determine mRNA quantity
is based on PCR, the assay to detect genomic DNA contamination also
needs to be performed using PCR (an agarose gel would not be sensitive
enough). A PCR across an exon–exon boundary for an abundant mRNA
should be used. A genomic DNA target may be used as control for the size
of a potential genomic DNA contamination band. The primers ATG GCA
AAT TCC ATG GCA and TGA TGA TCT TGA GGC TGT TGT C for the
GAPDH gene generate an amplicon of 285 bp from cDNA and an amplicon
of 453 bp from genomic DNA.
8.7.3 Reference gene validation
A number of reference (housekeeping) genes have been described in the
literature and are used at different frequencies. Suzuki and colleagues
reviewed 452 papers published in 1999, in six major journals, which used
real-time PCR for mRNA quantification (Suzuki et al., 2000) and found that
the most frequently used reference gene was GAPDH (33%), followed by
b-actin (32%) and 18S rRNA (14%). However, the value of some reference
genes has been questioned. For example, GAPDH, a commonly used refer-
ence gene, cannot be used in the analysis of breast tissue as its expression is
modulated by hormones (Laborda, 1991). The importance of assay- and
tissue-specific reference gene validation has also been illustrated by others
(Schmittgen and Zakrajsek, 2000, Sabek et al., 2002, Huggett et al., 2005).
The choice of a suitable reference gene is dependent the on individual
model and requires investigation of the appropriate literature. The choice of
reference genes is the main theme of Chapter 4.
8.7.4 Splice variants and splicing machinery
A number of diseases have recently been linked to mutations in genes
coding for proteins involved in mRNA splicing (Khan et al., 2002, Clavero et
al., 2004). Real-time PCR can be used to determine whether certain mRNA
but not others, are affected in these diseases. Primers are designed to
measure the relative expression of mRNA splice variants or the ratio of
sliced versus un-spliced mRNA.
8.7.5 Promoter switch
Sometimes the same gene can be expressed from different promoters. A real-
time PCR assay can be designed to address this issue. Primer design is very
restrictive under these circumstances as it is limited to the very 5’ end of the
RNA but, in principle, both TaqMan® and SYBR® Green assays can be used.
An example of promoter switch concerns the PEG1/MEST gene causing
biallelic expression in invasive breast cancer (Pedersen et al., 2002). Two
alternative transcripts have been described for this gene. A SYBR® Green
assay was useful to analyze the relative expression of each isoform in breast
cancers. The analysis of promoter switch being based on sequences located
in the very 5’ of an mRNA an oligo-dT cDNA synthesis may not be recom-
mended.
Real-time PCR using SYBR® Green 151
Figure 8.7A
Two allele-specific reverse primers (stars indicate mismatch) paired with a
common forward primer (not shown).
––
–– AC CC AA
124 bp
112 bp
8% Polyacrylamide gel
CC AA
AC
83 88
Temperature °C
Figure 8.7B
Joint use of size difference and melting curve analysis in allelic discrimination.
The top figure shows the gel electrophoresis for genotyping by size allelic
difference and the bottom figure shows the use of (negative derivative of)
melting curve to distinguish the three genotypes in a diallelic locus.
152 Real-time PCR
8.8 Allelic discrimination
The recent development of the SYBR® Green melting curve analysis assay
has allowed allelic discrimination assays to be performed much more easily
and less expensively than other methods. Both alleles of the gene of inter-
est can be co-amplified in a single PCR reaction based on one primer
discriminating the polymorphic site (allele specific PCR). The discrimina-
tion between the two alleles is based on one of these primers also being
much longer (additional 10 bp at least) resulting in a size difference for the
amplicons. The introduction of a SYBR® Green melting curve analysis assay
has helped considerably in resolving the difference in size between the
allele specific amplicons by providing a rapid mean of analysis length using
Tm. There are numerous examples in the literature (Donohoe et al., 2000,
Beuret, 2004) and a theoretical illustration of a basic allelic discrimination
assay using SYBR® Green detection method is given in Figures 8.7A and 8.7B.
8.9 Chromatin immunoprecipitation
Chromatin immunoprecipitation (ChIP) was recently developed and is a
very powerful tool to study in vivo interaction between proteins and DNA.
ChIP can be extremely useful in the study of transcription, as it enables the
identification of DNA regions that contain a transcription factor binding
site or that are susceptible to histone modifications such as methylation or
acetylation. It is, however, technically highly demanding and requires
efficient antibodies, particularly when analyzing transcription factors as
opposed to more abundant histone proteins.
The technique relies on fixing a protein of interest on its DNA target in
living cells, in order to isolate this specific complex, followed by PCR ampli-
fication to detect the target DNA. Intact cells are fixed using formaldehyde,
which cross-links protein to the DNA and therefore preserves specific
protein-DNA complexes. The DNA is then sheared into small pieces using
ultrasound. The complex between the protein of interest and its target DNA
is immunoprecipitated with an antibody specific to the protein, using
protein G agarose or magnetic beads. The DNA is extracted using a
proteinase K and phenol method, in order to reverse the cross-linking and
remove the proteins and antibodies. A PCR based method is then used to
detect the presence or absence of the target DNA in the immunoprecipitate.
Due to the very limited amount of DNA precipitated, particularly when
looking for transcription factor binding sites, a real-time method is highly
recommended and SYBR® Green assays perform very well (Wang et al.,
2004, Potratz et al., 2005).
Conclusion
This chapter outlines the many uses of SYBR® Green I-based real-time PCR.
Experimental protocols using SYBR® Green in gene quantification are
presented in Chapters 5 and 7. It appears that this inexpensive alternative
to specific probe-based chemistries has overcome the early skepticism about
its use. No doubt, developments in melting curve analysis have contributed
to its popularity and even allowed multiplexing of allelic discrimination
Real-time PCR using SYBR® Green 153
assays. SYBR® Green I or other recently discovered dsDNA binding dye-
based real-time PCR techniques can be used in allelic discrimination or
quantification assays and will most probably continue to gain popularity.
References
Alexander C, Votruba M, Pesch UE, Thiselton DL, Mayer S, Moore A, Rodriguez M,
Kellner U, Leo-Kottler B, Auburger G, Bhattacharya SS, Wissinger B (2000) OPA1,
encoding a dynamin-related GTPase, is mutated in autosomal dominant optic
atrophy linked to chromosome 3q28. Nat Genet 26(2): 211–215.
Beuret C (2004) Simultaneous detection of enteric viruses by multiplex real-time RT-
PCR. J Virol Methods 115(1): 1–8.
Clavero S, Perez B, Rincon A, Ugarte M, Desviat LR (2004) Qualitative and quantita-
tive analysis of the effect of splicing mutations in propionic acidemia underly-
ing non-severe phenotypes. Hum Genet 115(3): 239–247.
De Preter K, Speleman F, Combaret V, Lunec J, Laureys G, Eussen BH, Francotte N,
Board J, Pearson AD, De Paepe A, Van Roy N, Vandesompele J (2002)
Quantification of MYCN, DDX1, and NAG gene copy number in neuroblastoma
using a real-time quantitative PCR assay. Mod Pathol 15(2): 159–166.
Donohoe GG, Laaksonen M, Pulkki K, Ronnemaa T, Kairisto V (2000) Rapid single-
tube screening of the C282Y hemochromatosis mutation by real-time multiplex
allele-specific PCR without fluorescent probes. Clin Chem 46(10): 1540–1547.
Estalilla OC, Medeiros LJ, Manning JT, Jr, Luthra R (2000) 5’–>3’ exonuclease-based
real-time PCR assays for detecting the t(14;18)(q32;21): a survey of 162 malig-
nant lymphomas and reactive specimens. Mod Pathol 13(6): 661–666.
Huggett J, Dheda K, Bustin S, Zumla A (2005) Real-time RT-PCR normalisation:
strategies and considerations. Genes Immun 6(4): 279–284.
Karsai A, Muller S, Platz S, Hauser MT (2002) Evaluation of a homemade SYBR Green
I reaction mixture for real-time PCR quantification of gene expression.
Biotechniques 32(4): 790–792, 794–796.
Khan SG, Muniz-Medina V, Shahlavi T, Baker CC, Inui H, Ueda T, Emmert S,
Schneider TD, Kraemer KH (2002) The human XPC DNA repair gene: arrange-
ment, splice site information content and influence of a single nucleotide
polymorphism in a splice acceptor site on alternative splicing and function.
Nucleic Acids Res 30(16): 3624–3631.
Laborda J (1991) 36B4 cDNA used as an estradiol-independent mRNA control is the
cDNA for human acidic ribosomal phosphoprotein PO. Nucleic Acids Res 19(14):
3998.
Marchbank NJ, Craig JE, Leek JP, Toohey M, Churchill AJ, Markham AF, Mackey DA,
Toomes C, Inglehearn CF (2002) Deletion of the OPA1 gene in a dominant optic
atrophy family: evidence that haploinsufficiency is the cause of disease. J Med
Genet 39(8): e47.
Pedersen IS, Dervan P, McGoldrick A, Harrison M, Ponchel F, Speirs V, Isaacs JD,
Gorey T, McCann A (2002) Promoter switch: a novel mechanism causing
biallelic PEG1/MEST expression in invasive breast cancer. Hum Mol Genet 11(12):
1449–1453.
Ponchel F, Toomes C, Bransfield K, Leong FT, Douglas SH, Field SL, Bell SM,
Combaret V, Puisieux A, Mighell AJ, Robinson PA, Inglehearn CF, Isaacs JD,
Markham AF (2003) Real-time PCR based on SYBR-Green I fluorescence: an
alternative to the TaqMan assay for a relative quantification of gene rearrange-
ments, gene amplifications and micro gene deletions. BMC Biotechnol 3(1): 18.
Potratz JC, Mlody B, Berdel WE, Serve H, Muller-Tidow C (2005) In vivo analyses of
UV-irradiation-induced p53 promoter binding using a novel quantitative real-
time PCR assay. Int J Oncol 26(2): 493–498.
154 Real-time PCR
Sabek O, Dorak MT, Kotb M, Gaber AO, Gaber L (2002) Quantitative detection of T-
cell activation markers by real-time PCR in renal transplant rejection and corre-
lation with histopathologic evaluation. Transplantation 74(5): 701–707.
Schmittgen TD, Zakrajsek BA (2000) Effect of experimental treatment on housekeep-
ing gene expression: validation by real-time, quantitative RT-PCR. J Biochem
Biophys Methods 46(1–2): 69–81.
Suzuki T, Higgins PJ, Crawford DR (2000) Control selection for RNA quantitation.
Biotechniques 29(2): 332–337.
Wang JC, Derynck MK, Nonaka DF, Khodabakhsh DB, Haqq C, Yamamoto KR (2004)
Chromatin immunoprecipitation (ChIP) scanning identifies primary glucocorti-
coid receptor target genes. Proc Natl Acad Sci USA 101(44): 15603–15608.
High-resolution melting
analysis for scanning
and genotyping
9
Virginie Dujols, Noriko Kusukawa, Jason T. McKinney,
Steven F. Dobrowolsky and Carl T. Wittwer
9.1 Introduction
Ever since the introduction of the LightCycler® in 1996 (Wittwer et al.,
1997b), melting analysis has been an integral part of real-time techniques.
SYBR® Green I allows both quantification without probes (Wittwer et al.,
1997a) and verification of product identity by melting analysis (Ririe et al.,
1997). However, fine sequence discrimination (e.g. SNP genotyping) has
usually required labeled probes. Melting analysis for SNP typing was first
achieved with one labeled primer and one labeled probe (Lay and Wittwer,
1997) and later with two labeled probes, each with a single label (Bernard et
al., 1998). These techniques are widely used today with conventional real-
time instrumentation (Wittwer and Kusukawa, 2004, Gingeras et al., 2005).
New instruments and saturating double-stranded DNA binding dyes for
high-resolution melting enable mutation scanning and genotyping without
probes. High-resolution melting was first reported with labeled primers
(Gundry et al., 2003) for distinguishing different heterozygotes and
homozygotes. This was rapidly followed by the introduction of saturating
dyes, eliminating any need for fluorescently labeled oligonucleotides
(Wittwer et al., 2003). Because no separation steps are required, mutation
scanning by melting is inherently simple and inexpensive. The sensitivity
and specificity for detecting heterozygous SNPs is at least as good as alter-
native, more complicated techniques (Reed and Wittwer, 2004, Chou et al.,
2005). High-resolution melting for mutation scanning has been reported
for c-kit (Willmore et al., 2004), medium chain acyl-CoA dehydrogenase
(McKinney et al., 2004), SLC22A5 (Dobrowolski et al., 2005), and BRAF
(Willmore-Payne et al., 2005) genes. The method can be used for transplan-
tation matching by establishing sequence identity among related donors
within HLA genes (Zhou et al., 2004b). Complete genotyping is possible for
most SNPs (Liew et al., 2004, Graham et al., 2005) and bacterial speciation
has been reported (Odell et al., 2005). Unlabeled probes can be added when
regions of high sequence complexity are analyzed (Zhou et al., 2004a).
Because of its simplicity and power, we suspect high-resolution melting
techniques will become integrated into real-time platforms, perhaps even
by the publication of this book. In what follows, we briefly describe the
156 Real-time PCR
instrumentation and saturation dyes that make high-resolution melting
analysis possible. Next we present experimental details for mutation
scanning, followed by amplicon genotyping and unlabeled probe genotyp-
ing. Finally, we compare high-resolution melting analysis to other options
for scanning and homogeneous genotyping.
9.2 High-resolution instrumentation
9.2.1 The HR-1™ instrument
High-resolution melting was first developed on an instrument that analyzes
individual 10 μl samples in Roche LightCycler® capillaries one at a time
(Gundry et al., 2003). Our goal was to investigate the potential power of
melting analysis by using the highest resolution possible. The thermal
advantages of symmetric capillaries with a high-surface area-to-volume
ratio were combined with the stability of a surrounding metal ingot for
heating. A single LED with feedback control of intensity for excitation and
a photodiode for detection were configured for epi-illumination of the
capillary tip. High-resolution 24-bit A-to-D converters were used for digital
processing of both temperature and fluorescence. Melting curves with
50–100 points/°C were obtained. The increase in resolution is about 1–2
orders of magnitude greater than in conventional real-time instruments
(Zhou et al., 2005). The instrument has been commercialized by Idaho
Technology as the HR-1™ high-resolution melting instrument.
Compared to real-time instruments, the HR-1™ is inexpensive. However,
it is not designed for thermal cycling and only one sample can be analyzed
at a time. Nevertheless, with a 1–2 min turn-around time, throughput is
reasonable at about 45 samples per hour. It is most convenient to amplify
the samples in a LightCycler® as the real time PCR data is valuable for
optimization, and then transfer the capillaries to the HR-1™. However, real-
time PCR is not requisite for high-resolution melting analysis, and amplifi-
cation can occur on any PCR instrument. Transfer of the sample into a
capillary is necessary before melting unless a capillary PCR instrument, such
as the RapidCycler® 2 (Idaho Technology), is used.
9.2.2 The LightScanner™ instrument
Even though the throughput of the HR-1™ is reasonable, the manual
handling of single samples is tedious for large numbers of samples and the
possibility of manipulation errors is real. The LightScanner™ (Idaho
Technology) is a 96- or 384-well microtiter format high-resolution melting
instrument designed for high-throughput use. PCR is first performed on any
plate thermocycler. The plate is then transferred to the LightScanner™ for
melting analysis. Since the cycle time of the LightScanner™ is 5–10 min,
many thermocyclers can feed a single LightScanner™. Sample volumes of
10 μl are standard, although 5 μl or less can be used.
Various commercial PCR plates each have unique optical properties. The
best plates have opaque white wells in a black shell (BioRad/MJ Research or
Idaho Technology) and are available in 96- and 384-well format. However,
not all 96-well PCR instruments are physically compatible with these plates.
High-resolution melting analysis for scanning and genotyping 157
An oil overlay (15–20 μl per well for 96-well plates or 10–15 μl per well for
384-well plates) is necessary to prevent sample evaporation during melting
analysis in the LightScanner™. Sample evaporation increases the ionic
strength and changes the characteristics of the melting profile. The oil is
applied before PCR immediately after the samples are placed in the wells
(row by row or column by column). Alternatively the samples are under-
layed beneath pre-aliquoted oil. In either case, it is wise to spin the plates in
a centrifuge (although the adept can ‘flick’ the plates by hand) to ensure
that the oil and sample are properly layered.
9.2.3 The LightCycler® 480 instrument
Real-time instruments not specifically designed for high-resolution melting
analysis perform poorly in comparison to the HR-1™ and the LightScanner™
(Herrmann et al., 2006). A possible exception may prove to be the
LightCycler® 480 (Roche), the latest in the LightCycler® line of instruments
that is a 96/384-well real-time instrument. We were able to test a prototype
version of the LightCycler® 480 for mutation scanning and obtained compa-
rable results to the HR-1™ and the LightScanner™ using previously described
methods (Reed and Wittwer, 2004). No oil overlay is required, but the recom-
mended sample volumes are larger (20 μl). All three instruments (HR-1™,
LightScanner™, LightCycler® 480) perform well for mutation scanning and
unlabeled probe genotyping. However, the plate-based instruments are not
recommended for amplicon genotyping because even small well-to-well
temperature variations may be greater than the absolute Tm difference
between some homozygotes (Liew et al., 2004). Characteristics of the instru-
ments are summarized in Table 9.1. We suspect that additional instruments
will incorporate high-resolution capabilities in the future.
Table 9.1 Characteristics of high-resolution melting instruments
Characteristic HR-1™ LightScanner™ LightCycler® 480
Number of samples per run 1 96, 384 96, 384
Turn-around time (min) 1–2 10–15 20
Sample volume (μl) 5–10 5–10 10–20
Capabilities
Mutation scanning + + +
Unlabeled probe genotyping + + +
Amplicon genotyping + – –
Integrated PCR No No Yes
Oil overlay No Yes No
Instrument cost low moderate high (projected)
Running costs (reagents/tubes) moderate low unknown
9.3 Saturating dyes
Using dyes instead of probes for genotyping has been a challenge. Early
reports of using SYBR® Green I for genotyping (Marziliano et al., 2000,
Pirulli et al., 2000) have been questioned (von Ahsen et al., 2001). Most
subsequent work with SYBR® Green I processed the samples after PCR,
158 Real-time PCR
including product purification and dye addition (Lipsky et al., 2001) or the
addition of urea (Elenitoba-Johnson and Bohling, 2001). In our hands, it is
not possible to reliably detect heteroduplexes with SYBR® Green I in a
closed-tube system. When multiple duplexes are present, SYBR® Green I
adequately detects high Tm products during melting, but not lower Tm
products (Wittwer et al., 2003). Various reasons for this have been proposed,
including dye redistribution during melting (Wittwer et al., 2003), strand
reassociation during melting (Gundry et al., 2003), and G:C base pair speci-
ficity (Giglio et al., 2003). At least with small amplicons, faster melting rates
(0.1–0.3°C/s) can minimize any effect of strand reassociation during
melting (Gundry et al., 2003).
Dye redistribution during melting appears to be the major limitation of
SYBR® Green I for heteroduplex detection. Heteroduplexes may be detected
with SYBR® Green I if high enough concentrations are used (Lipsky et al.,
2001). However, at these high concentrations PCR is inhibited (Wittwer et
al., 1997a). The ideal dye would saturate all double-stranded DNA produced
during PCR (eliminating dye redistribution) and not inhibit or otherwise
adversely affect PCR.
9.3.1 LCGreen™ dyes
We have synthesized a number of asymmetric cyanine dyes whose basic
structure is shown in Figure 9.1. Many of these dyes, generically called
’LCGreen™’ dyes, can be used in PCR at saturating concentrations without
inhibition. They differ in structure from the more common asymmetric
cyanines (Zipper et al., 2004) by the presence of two nitrogens in the right
ring, hence they are pyrimidiniums as opposed to pyridiniums. Different
properties are obtained by replacing X, R1, R2, and R3 with different
moieties. Two of the most useful dyes are LCGreen™ I (introduced with the
HR-1™ instrument) and LCGreen™ PLUS (introduced with the
LightScanner™) both available from Idaho Technology. LCGreen™ PLUS is
much brighter than LCGreen™ I and can be used on most real-time PCR
machines, within the resolution constraints of each instrument. The exact
Figure 9.1
The basic structure of the LCGreen™ dye family. LCGreen™ dyes are asymmetric
cyanines, different from SYBR® Green I by having two nitrogens in the right ring.
Various properties are obtained by modifying the substituents X, R1, R2, and R3. X
is usually S or O. R1, R2 and R3 are hydrogens, aliphatic or aromatic moieties that
may be branched or linear, charged or uncharged. LCGreen™ I and LCGreen™
PLUS are two commercial versions of the LCGreen™ dye family.
High-resolution melting analysis for scanning and genotyping 159
structure of LCGreen™ I and LCGreen™ PLUS is kept a trade secret, as is the
usual practice for commercial dyes in this field. The binding mode of the
LCGreen™ dyes has not been investigated, but by analogy to SYBR® Green
I (Zipper et al., 2004) it is likely that both intercalation and surface binding
occur, with fluorescence dependent on the later.
9.4 Mutation scanning
Closed-tube mutation scanning is perhaps the most important application
of high-resolution melting analysis. Mutation scanning techniques detect
any heterozygous sequence change between the PCR primers. Conven-
tional methods of mutation scanning require downstream processing, a
separation step after PCR, or both. In contrast, mutation scanning by
melting is performed in the same tube as PCR without any modification to
the amplification except the addition of a saturating dye to the reaction
prior to PCR. Like SYBR Green® I, LCGreen™ dyes raise the Tm of primers
and the PCR product by a few °C, so some re-optimization of PCR tempera-
tures may be necessary. If high melting temperatures are a problem, DMSO
(5–10%) can be added without adverse affect to the melting analysis. This is
often useful in regions of high GC content.
Primers are chosen to bracket the analysis region, often entire exons includ-
ing adjacent intron sequence critical to mRNA processing. The sensitivity and
specificity of detection depend somewhat on amplicon size. SNP detection
approaches 100% for amplicons <400 bp in length, while the sensitivity and
specificity for 400–1,000 bp products is 96.1 and 99.4% respectively (Reed and
Wittwer, 2004). Longer amplicons often have multiple melting transitions,
although such ‘domains’ may be present in any amplicon depending on
sequence. Scanning sensitivity does not appear to depend on the position of
the variant within the amplicon or the number of melting domains.
9.4.1 PCR protocols for scanning
Any recipe for PCR can be used with the simple addition of an LCGreen™
dye at 1X concentration. If capillaries are used for amplification, 250–500
μg/ml BSA (final concentration) should be added. We routinely use 50 mM
Tris, pH 8.3, 500 μg/ml BSA, 200 μM each dNTP, 1–5 mM MgCl2, 0.4 U heat-
stable polymerase, 88 ng of TaqStart™ antibody (ClonTech), 0.2–0.5 μM
each primer and 10–50 ng of human genomic DNA in 10 μl reactions. One
μl of human genomic DNA with an absorbance of 1.0 at 260 nm provides
50 ng or 15,000 copies of DNA. Either an exonuclease-positive (Roche) or
exonuclease-negative polymerase (KlenTaq1™, AB Peptides) can be used.
Alternatively, dye can be added to LightCycler® FastStart DNA Master
HybProbe PCR kit (Roche). It is likely that by the time of publication of this
book, complete PCR master mixes including the LCGreen™ dye will be
available from Idaho Technology, Roche, or both. Hot-start procedures
(physical temperature, wax barrier, anti-Taq antibody, or heat-activated
enzymes), although not required, are recommended. All double-stranded
DNA species bind LCGreen™ dyes and affect the melting profile, and
although it is often possible to ‘read through’ undesired amplified products,
it is much easier to interpret specific, single product amplifications.
160 Real-time PCR
Temperature cycling protocols and optimization will not be detailed here.
The goal is a pure PCR product, so rapid cycling, hot-start techniques, and a
limited number of cycles (30–40) are recommended. Parameters for rapid
capillary PCR have been published elsewhere (Wittwer et al., 2001),
although denaturation times must be modified if heat-activated Taq is used.
Rapid cycling is not required, and standard PCR on 96- or 384-well plates is
the best high-throughput solution. Gradient thermal cyclers are convenient
for initial optimization. Real-time monitoring is not necessary, but is conve-
nient and aids in troubleshooting. After PCR the samples should be
denatured and cooled rapidly. With capillary systems, a brief ‘0’ sec denat-
uration is adequate. On plate thermocyclers, a 10–30 sec denaturation is
recommended. In either case, cool the samples to below 40°C at the fastest
ramp possible. The samples can be melted immediately or stored at room
temperature before analysis. If plates have been covered with a film for
thermal cycling, remove the film before melting. Melting rates for scanning
are usually 0.3°C/sec on the HR-1™ and 0.1°C/sec on the LightScanner™.
9.4.2 Principles of scanning by melting
The principle behind heterozygote detection by melting is shown in Figure
9.2. PCR amplification of a heterozygous SNP produces four different single-
stranded products, indicated as A, C, G, and T in Figure 9.2. If these strands
are randomly associated after PCR by denaturation and annealing, four
unique duplexes are formed. Two fully base paired fragments are identical
to the starting DNA and are close (but usually not identical) in melting
temperature. In addition, two imperfectly matched heteroduplexes are
Figure 9.2
Heterozygote detection by melting analysis. When a heterozygous sample is
amplified by PCR, denatured, and cooled, the strands re-associate randomly,
producing four distinct duplexes. The two homoduplexes and two
heteroduplexes that are produced cannot be observed individually during
melting. Rather, the composite melting curve of all four duplexes results in a
skewed melting curve with a broad melting transition. The altered shape of the
melting curve is used to identify heterozygotes.
High-resolution melting analysis for scanning and genotyping 161
formed that melt at lower temperatures than the fully base paired
fragments. All four duplexes are present when a heterozygous sample is
melted, so the observed melting curve is a superposition of all four melting
profiles. The result is usually a skewed melting curve with a broad transi-
tion. The best indicator for the presence of a heterozygous sample is the
altered shape of the melting profile. The melting temperature, or Tm, is less
sensitive and not as relevant as melting curve shape.
9.4.3 Software tools for heterozygote identification
Sequence variant identification by visual inspection of the melting curves
is surprisingly easy with the appropriate software tools. The process is
demonstrated in Figure 9.3 (A–D) for a 179 bp product of the cholesterol
esterase transfer protein gene. The original high-resolution data is shown in
(A). The wild type sequence is shown in black with different sequence
variants in various colors. At low temperature before any DNA melting
transition, fluorescence decreases with increasing temperature. This
linear decrease in fluorescence with increasing temperature is a property of
fluorescence unrelated to DNA melting.
To normalize the data, two linear regions are selected, one before and one
after the major transition. These regions define two lines for each curve, an
upper 100% fluorescence line and a lower, 0% baseline. The percent fluores-
cence within the transition (between the two regions) is calculated at each
temperature as the distance to the experimental data compared to the
distance between the extrapolated upper and lower lines. The normalized
result is shown in (B).
The shape difference between genotypes can be made clearer by eliminat-
ing the temperature offsets between samples by shifting the temperature
axis of each curve so that the curves are partly superimposed. This is usually
done at the high temperature homoduplex region (low percent fluores-
cence) of the curves so that heteroduplexes can be identified by their early
drop in fluorescence at lower temperatures, as shown in (C).
Different genotypes are most easily distinguished by plotting the fluores-
cence difference between normalized and temperature-shifted melting
curves. A reference genotype is selected and the difference between all other
curves and the reference is plotted against temperature, as shown in (D).
Genotypes other than the reference trace unique paths that can be easily
identified visually. Difference plots should not be confused with derivative
plots often used to visualize probe Tm values for genotyping (Lay and
Wittwer, 1997, Bernard et al., 1998). Although there is some visual similar-
ity, the plots and their applications are very different.
Visual inspection is convenient when there are only a few samples to
study. However, when there are many curves to compare, intuitive visual
clustering becomes less attractive than automatic clustering. Classical
hierarchical clustering can identify different genotypes after high-resolu-
tion melting analysis (Zhou et al., 2005). Although automatic clustering
algorithms can be used, it is wise to always visually look at the data,
especially when multiple domains are present. Commercial software avail-
able with the HR-1™ and LightScanner™ instruments incorporates these
basic analysis components.
162 Real-time PCR
Original Figure 9.3
100 Software-aided analysis for
Used for
normalization mutation scanning. Thirty-
two different human
75
genomic DNA samples were
Fluorescence
amplified in the LightCycler®
50 and analyzed on the HR-1™
instrument. The original
melting data (Original) is
25 normalized (Step 1) and
temperature-shifted (Step 2)
0 to compare the shape of the
86 88 90 melting transitions.
Differences in shape are most
Step 1. Normalized easily seen on difference plots
100 (Step 3) of the normalized
and temperature shifted data.
Wild-type samples are in
75
black, with sequence variants
Fluorescence
in different colors.
50
25
0
86 88 90
Step 2. Temperature shifted
100
75
Fluorescence
50
25
0
86 88 90
Step 3. Difference
32
24
D Fluorescence
16
8
0
–4
86 88 90
Temperature (°C)
High-resolution melting analysis for scanning and genotyping 163
9.4.4 Scanning for homozygous variants
Although the most common sequence variants are heterozygous, it is also
important to identify homozygous variants. In general, scanning methods
do not identify homozygous changes unless the unknown samples are
mixed with wild type before analysis. High-resolution melting analysis is an
exception to this rule as many homozygous variants can be identified
directly (Gundry et al., 2003, Wittwer et al., 2003, Dobrowolski et al., 2005).
For example, the A>T base change of HbS can be detected in the homozy-
gous state (sickle cell disease) even though the Tm shift is only 0.1–0.2°C.
Sometimes the shape of the melting curve is sufficiently different that
homozygous variants can be picked up on standard scanning plots (differ-
ence plots of normalized, temperature-shifted data). This occurs, for
example, when the melting curve has multiple domains and the sequence
change affects only one of them (Wittwer et al., 2003). However, in many
cases, the shape of the homozygous variant curve is nearly identical to the
wild-type curve. Therefore, as a general rule, temperature shifting is not
performed when the objective is to identify homozygous changes and
absolute temperatures must be relied upon. This places stringent require-
ments on the temperature precision of an instrument between samples,
either in time (HR-1™) or space (LightScanner™). In practice, the HR-1™
performs better than the LightScanner™ because of temperature variation
across sample wells in heating blocks. Fewer homozygous variants will be
detected on 96- or 384-well instruments than on the HR-1™.
Systematic studies to estimate the sensitivity and specificity of homozy-
gous variant detection have yet to be performed. Detection of homozygous
SNP changes is often easier than small, homozygous insertions or deletions
because the later may be very close in Tm to the wild type. For example, the
homozygous G542X SNP in cystic fibrosis is detectable by high-resolution
melting, while homozygous F508del is not (Chou et al., 2005). Studies with
small amplicons have shown that 84% of human SNPs have homozygous
Tm differences between 0.8–1.4°C (Liew et al., 2004), suggesting that most
SNPs are detectable. Whether they are detected will depend on the ampli-
con size and the resolution of the instrument used.
9.5 Amplicon genotyping
Because both homozygous and heterozygous variants can be distinguished
from wild type, specific loci can be genotyped by amplicon melting.
Protocols are identical to mutation scanning except that small amplicons are
recommended to increase the melting curve differences between SNP
genotypes (Liew et al., 2004). Heterozygotes are always easy to identify
because low melting heteroduplexes change the shape of the melting curve.
The homozygotes of most SNPs are readily distinguished from wild type with
Tm differences of about 1°C. However, about 12% of human SNPs are
challenging with differences of about 0.2°C and 4% are impossible because
of thermodynamic symmetry. The SNPs that are difficult can be predicted by
the type of SNP (Liew et al., 2004). The impossible SNPs can be genotyped
after mixing with wild type sample either before or after PCR. When mixed
after PCR, equal amounts of wild type and unknown amplicons are mixed,
164 Real-time PCR
denatured, annealed, and melted again. If the unknown is wild type, no
change in the melting curve occurs. If the unknown is homozygous mutant,
the new melting curve appears heterozygous. Slightly more elegant is mixing
before PCR. In this case, the ideal amount of wild-type DNA is one part
added to six parts of unknown DNA. The melting curves of all three
genotypes are separated based on the proportion of heteroduplexes formed.
When mixing before PCR, only one melting analysis is needed and genotyp-
ing remains closed-tube.
Because the Tm differences between homozygous mutant and wild type
may be smaller than the temperature variation across 96- or 384-well
blocks, only the HR-1™ is recommended for amplicon genotyping
(Herrmann et al., 2006). The ability of HR-1™ genotyping to distinguish
different heterozygotes was recently demonstrated (Graham et al., 2005).
Twenty-one out of 21 heteroduplex pairs tested were distinguishable by
high-resolution melting of small amplicons.
9.6 Unlabeled probe genotyping
LCGreen™ dyes are fluorescent in the presence of any double-stranded
DNA. For mutation scanning and amplicon genotyping, entire amplicons
are labeled with dye. Recently, we found that the melting transition of
unlabeled oligonucleotides probes could also be monitored with these dyes
(Zhou et al., 2004a). If excess single-stranded product is produced by
asymmetric PCR, the Tm of unlabeled probes can be used for genotyping,
similar to methods that use covalently-labeled fluorescent oligonucleotides
(Lay and Wittwer, 1997, Bernard et al., 1998). Primer asymmetry ratios of
1:5 to 1:10 produce sufficient double-stranded product for amplicon
melting and enough single-stranded product for probe annealing.
Unlabeled genotyping probes typically incorporate a 3’ phosphate,
although any terminator that prevents extension can be used. In contrast to
the LCGreen™ dyes, SYBR® Green I does not adequately distinguish
heterozygotes queried with unlabeled probes.
Unlabeled probes of 20–30 bases with Tm values from 55–70°C give good
peaks on derivative plots. When an exonuclease-negative polymerase is
used, the Tm of the most stable hybrid should be below the extension
temperature of PCR to avoid possible blockage of the polymerase by the
probe. Such blockage can be allele-specific and result in incorrect genotyp-
ing. Alternatively, exonuclease-positive polymerases can be used with probe
Tm values into the 80s without concern. It is convenient to position the
most stable probe transition below that of possible primer dimers to avoid
potential confusion. Nearest-neighbor thermodynamic estimates of probe
Tm are usually 1–4°C lower than observed Tm values, primarily because of
dye stabilization of the hybrid (Zhou et al., 2004a).
9.6.1 PCR protocols for unlabeled probe genotyping
Similar to scanning and amplicon genotyping, any recipe for PCR can be
used with the simple addition of LCGreen™ dyes at 1X concentration. We
routinely use 50 mM Tris, pH 8.3, 500 μg/ml BSA, 200 μM each dNTP, 1–5
mM MgCl2, 0.4 U heat-stable polymerase, 88 ng of TaqStart™ antibody
High-resolution melting analysis for scanning and genotyping 165
(ClonTech), 0.5 μM of the excess primer, 0.05–0.1 uM of the limiting
primer, 0.5 uM of the unlabeled probe and 50 ng of human genomic DNA
in 10 μl reactions. Make sure that the unlabeled probe is on the same strand
as the limiting primer. Polymerase alternatives include regular exonuclease-
positive Taq (for a wide range of probe Tm values) and exonuclease-negative
KlenTaq1™ (for probe Tm values below the PCR extension temperature).
We have also added dye to the LightCycler® FastStart DNA Master HybProbe
kit with good results. Hot-start procedures are not as important as in
scanning applications, especially if the probes are designed so that alleles
melt below potential primer dimers. Asymmetric amplification is usually
performed for 45–60 cycles, so rapid cycling techniques are convenient. A
final denaturation and cooling step are not required.
9.6.2 Instrumentation for unlabeled probe genotyping
In contrast to mutation scanning and amplicon genotyping, high-resolution
melting analysis is not required with unlabeled probes. Results are best on
the HR-1™ and LightScanner™, but the LightTyper™ and the LightCycler®
produce adequate genotyping results (Zhou et al., 2004a). Although other
real-time PCR instruments have not been tested, unlabeled probe geno-
typing should be possible with LCGreen™ PLUS. Recommended melting
rates for unlabeled probe genotyping are 0.1°C for the LightScanner™ and
0.3°C/sec for the HR-1™. Background fluorescence from single strands
(primers and single stranded product) is prominent at low temperatures.
However, conversion of the original data directly to derivative curves reveals
the melting transitions as peaks on a downward slope (Figure 9.4).
9.6.3 Simultaneous genotyping and scanning
Unlabeled probe genotyping can be combined with amplicon scanning in
the same reaction (Zhou et al., 2005). Both probe melting (for genotyping)
and the amplicon melting (for scanning) are analyzed from the same
melting curve. Reaction conditions and design are the same as with
unlabeled probes with the exception that denaturation and cooling after
PCR is required for heteroduplex formation. High-resolution instrumenta-
tion is required. Multiple unlabeled probes can be used in the same
reaction, as long as the Tm values of all alleles are unique. The melting
temperature of different probe/allele duplexes can be adjusted by probe
length, mismatch position, and probe dU vs. dT content. Combined
scanning and genotyping with LCGreen™ dyes presents a powerful closed-
tube genetic analysis system. The method is only as complex as PCR, yet
promises to vastly reduce the need for re-sequencing.
9.7 Simplification of genotyping and mutation scanning
Four alternative designs for genotyping by melting analysis are shown in
Figure 9.4. Conventional HybProbe® technology requires two probes, each
with a single fluorescent label (Bernard et al., 1998). Single HybProbes® (also
known as SimpleProbes®) only require one probe with a single label
(Crockett and Wittwer, 2001). Unlabeled probe genotyping depends on
166 Real-time PCR
Number required Derivative of
Design
Probes Labels melting curve
Adjacent HybProbe
A
Two Two G
C
SimpleProbe
A
One One G
C
Unlabeled Probe (LCGreen dye)
A
One None
G
C
Amplicon Melting (LCGreen dye)
A
None None G
C
Figure 9.4
Four different methods of SNP typing by melting. Shown for each method are
the number of probes and fluorescent labels required, the hybridization design,
and the negative derivative of the resultant melting curve. The melting curves of
each method (dF/dT vs temperature) show plots of wild-type (long dashes),
heterozygous (solid lines), homozygous mutant (dots), and no template controls
(grey dashes). The top two methods use covalently-attached fluorescent labels
(depicted by open and closed circles), whereas the bottom two methods use a
saturating DNA dye.
saturation dyes for fluorescence with no covalent fluorescent labels. Finally,
genotyping by amplicon melting also relies on saturation dyes and requires
no probes.
Closed-tube genotyping methods that use melting analysis are less
complex than allele specific alternatives that require one probe for each
allele analyzed (Table 9.2). Melting techniques also have the capacity to
scan for unexpected variants under the probes and/or within amplicons.
Allele discrimination by Tm (Wittwer et al., 2001) or curve shape (Wittwer
et al., 2003, Graham et al., 2005) are promising alternatives to fluorescent
color. Conventional closed-tube genotyping methods require expensive
fluorescent labels. Conventional scanning techniques, such as SSCP, DGGE,
TGGE, heteroduplex analysis, DHPLC, TGCE, and chemical or enzymatic
mismatch detection methods require processing and separation steps after
High-resolution melting analysis for scanning and genotyping 167
Table 9.2 Comparison of closed-tube, homogeneous SNP genotyping and scanning methods
Method (references) Probes/SNP Modifications/ Scanning region
genotype probe
Amplicon melting 0 0 Between primers
(Gundry et al., 2003)
(Wittwer et al., 2003)
(Liew et al., 2004)
(Graham et al., 2005)
Unlabeled probe 1 0 Between primers and within probes
(Zhou et al., 2004a)
Simple probe 1 1 Within probe
(Crockett and Wittwer, 2001)
Hybridization probes 2 1 Within probes
(Bernard et al., 1998)
TaqMan® 2 2 None
(Lee et al., 1993)
Beacons 2 2 None
(Marras et al., 2003)
Scorpions 2 3 None
(Whitcombe et al., 1999)
MGB TaqMan® 2 3 None
(de Kok et al., 2002)
PCR (Wittwer and Kusukawa, 2005). Closed-tube genotyping and scanning
with LCGreen™ dyes are attractive because: 1) there are no processing or
separation steps after the initiation of PCR, 2) only standard PCR reagents,
unlabeled oligonucleotides, and a saturating DNA dye are required, and 3)
analysis is rapid (1–10 min after PCR).
References
Bernard PS, Ajioka RS, Kushner JP, Wittwer CT (1998) Homogeneous multiplex
genotyping of hemochromatosis mutations with fluorescent hybridization
probes. Am J Pathol 153: 1055–1061.
Chou L-S, Lyon E, Wittwer CT (2005) A comparison of high-resolution melting
analysis to denaturing high performance liquid chromatography for mutation
scanning: cystic fibrosis transmembrane conductance regulator gene as a model.
Am J Clin Pathol 124: 330–338.
Crockett AO, Wittwer CT (2001) Fluorescein-labeled oligonucleotides for real-time
pcr: using the inherent quenching of deoxyguanosine nucleotides. Anal Biochem
290: 89–97.
de Kok JB, Wiegerinck ET, Giesendorf BA, Swinkels DW (2002) Rapid genotyping of
single nucleotide polymorphisms using novel minor groove binding DNA
oligonucleotides (MGB probes). Hum Mutat 19: 554–559.
Dobrowolski SF, McKinney JT, Amat di San Filippo C, Giak Sim K, Wilcken B, Longo
N (2005) Validation of dye-binding/high-resolution thermal denaturation
for the identification of mutations in the SLC22A5 gene. Hum Mutat 25:
306–313.
168 Real-time PCR
Elenitoba-Johnson KS, Bohling SD (2001) Solution-based scanning for single-base
alterations using a double-stranded DNA binding dye and fluorescence-melting
profiles. Am J Pathol 159: 845–853.
Giglio S, Monis PT, Saint CP (2003) Demonstration of preferential binding of SYBR
Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res
31: e136.
Gingeras TR, Higuchi R, Kricka LJ, Lo YM, Wittwer CT (2005) Fifty years of molecular
(DNA/RNA) diagnostics. Clin Chem 51: 661–671.
Graham R, Liew M, Meadows C, Lyon E, Wittwer CT (2005) Distinguishing different
DNA heterozygotes by high-resolution melting. Clin Chem 51: 1295–1298.
Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, Wittwer CT (2003)
Amplicon melting analysis with labeled primers: a closed-tube method for
differentiating homozygotes and heterozygotes. Clin Chem 49: 396–406.
Herrmann MG, Durtschi JD, Bromley LK, Wittwer CT, Voelkerding KV (2006) DNA
welting analysis for mutation scanning and genotyping: a cross platform
comparison. Clin Chem in press.
Lay MJ, Wittwer CT (1997) Real-time fluorescence genotyping of factor V Leiden
during rapid-cycle PCR. Clin Chem 43: 2262–2267.
Lee LG, Connell CR, Bloch W (1993) Allelic discrimination by nick-translation PCR
with fluorogenic probes. Nucleic Acids Res 21: 3761–3766.
Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, Wittwer C (2004) Genotyping
of single-nucleotide polymorphisms by high-resolution melting of small ampli-
cons. Clin Chem 50: 1156–1164.
Lipsky RH, Mazzanti CM, Rudolph JG, Xu K, Vyas G, Bozak D, Radel MQ, Goldman
D (2001) DNA melting analysis for detection of single nucleotide polymor-
phisms. Clin Chem 47: 635–644.
Marras SA, Kramer FR, Tyagi S (2003) Genotyping SNPs with molecular beacons.
Methods Mol Biol 212: 111–128.
Marziliano N, Pelo E, Minuti B, Passerini I, Torricelli F, Da Prato L (2000) Melting
temperature assay for a UGT1A gene variant in Gilbert syndrome. Clin Chem 46:
423–425.
McKinney JT, Longo N, Hahn SH, Matern D, Rinaldo P, Strauss AW, Dobrowolski SF
(2004) Rapid, comprehensive screening of the human medium chain acyl-CoA
dehydrogenase gene. Mol Genet Metab 82: 112–120.
Odell ID, Cloud JL, Seipp M, Wittwer CT (2005) Rapid species identification within
the Mycobacterium chelonae-abscessus group by high-resolution melting analy-
sis of hsp65 PCR products. Am J Clin Pathol 123: 96–101.
Pirulli D, Boniotto M, Puzzer D, Spano A, Amoroso A, Crovella S (2000) Flexibility of
melting temperature assay for rapid detection of insertions, deletions, and
single-point mutations of the AGXT gene responsible for type 1 primary hyper-
oxaluria. Clin Chem 46: 1842–1844.
Reed GH, Wittwer CT (2004) Sensitivity and specificity of single-nucleotide poly-
morphism scanning by high-resolution melting analysis. Clin Chem 50:
1748–1754.
Ririe KM, Rasmussen RP, Wittwer CT (1997) Product differentiation by analysis of
DNA melting curves during the polymerase chain reaction. Anal Biochem 245:
154–160.
von Ahsen N, Oellerich M, Schutz E (2001) Limitations of genotyping based on
amplicon melting temperature. Clin Chem 47: 1331–1332.
Whitcombe D, Theaker J, Guy SP, Brown T, Little S (1999) Detection of PCR products
using self-probing amplicons and fluorescence. Nat Biotechnol 17: 804–807.
Willmore C, Holden JA, Zhou L, Tripp S, Wittwer CT, Layfield LJ (2004) Detection of
c-kit-activating mutations in gastrointestinal stromal tumors by high-resolution
amplicon melting analysis. Am J Clin Pathol 122: 206–216.
High-resolution melting analysis for scanning and genotyping 169
Willmore-Payne C, Holden JA, Tripp S, Layfield LJ (2005) Human malignant
melanoma: Detection of BRAF- and c-kit-activating mutations by high-resolu-
tion amplicon melting analysis. Hum Pathol 36: 486–493.
Wittwer CT, Herrmann MG, Gundry CN, Elenitoba-Johnson KS (2001) Real-time
multiplex PCR assays. Methods 25: 430–442.
Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP (1997a) Continuous fluores-
cence monitoring of rapid cycle DNA amplification. Biotechniques 22: 130–131,
134–138.
Wittwer CT, Ririe KM, Andrew RV, David DA, Gundry RA, Balis UJ (1997b) The
LightCycler: a microvolume multisample fluorimeter with rapid temperature
control. Biotechniques 22: 176–181.
Wittwer CT, Kusukawa N (2004) Diagnostic molecular microbiology; principles and
applications. In: Persing DH, Tenover FC, Versalovic J, Tang YW, Unger ER,
Relman DA, White TJ (eds), Real-time PCR. ASM Press, Washington DC, 71–84.
Wittwer CT, Kusukawa N (2005) Nucleic acid techniques. In: Tietz Textbook of
Clinical Chemistry and Molecular Diagnostics, 4th edition Burtis C, Ashwood E,
Bruns D (eds), Elsevier, New York, 1407–1449.
Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ (2003) High-resolution
genotyping by amplicon melting analysis using LCGreen. Clin Chem 49:
853–860.
Zhou L, Myers AN, Vandersteen JG, Wang L, Wittwer CT (2004a) Closed-tube
genotyping with unlabeled oligonucleotide probes and a saturating DNA dye.
Clin Chem 50: 1328–1335.
Zhou L, Vandersteen J, Wang L, Fuller T, Taylor M, Palais B, Wittwer CT (2004b)
High-resolution DNA melting curve analysis to establish HLA genotypic
identity. Tissue Antigens 64: 156–164.
Zhou L, Wang L, Palais R, Pryor R, Wittwer CT (2005) High-resolution DNA melting
analysis for simultaneous mutation scanning and genotyping in solution. Clin
Chem 51: 1770–1777.
Zipper H, Brunner H, Bernhagen J, Vitzthum F (2004) Investigations on DNA inter-
calation and surface binding by SYBR Green I, its structure determination and
methodological implications. Nucleic Acids Res 32: e103.
Quantitative analyses of
DNA methylation
Lin Zhou and James (Jianming) Tang
10
10.1 Introduction
As an epigenetic and inheritable trait, DNA methylation is well-known for
its role in important biological phenomena, including X-chromosome
inactivation (in females), genetic imprinting, cell differentiation, and
mutagenesis (Robertson and Wolffe, 2000, Feinberg et al., 2002, Fitzpatrick
and Wilson, 2003, Muegge et al., 2003). In the human genome, DNA
methylation primarily involves about 70% of all cytosines in the context of
5’-CG-3’ (CpG) dinucleotides. Fine mapping of CpG methylation has been
a major goal of the Human Epigenome Project (HEP), and the first major
product derived from this international effort has been published recently
(Rakyan et al., 2004).
Methylated cytosine (mC) differs from cytosine in two biochemical
properties. First, treatment of DNA with bisulfite converts normal cytosine
to uracil, while mC remains intact. Second, many methylation-sensitive
restriction endonucleases are unable to cleave target DNA when mC is
present within the recognition site. These properties form the basis for CpG
methylation analyses.
Quantification of CpG methylation can be done with a variety of PCR-
based techniques (see Table 10.1), each with clear advantages and disad-
vantages (reviewed by (Geisler et al., 2004)). For example, when a single
CpG site is targeted, methylation-specific PCR (MSP) can be used to measure
the proportion of mC to normal cytosine in bisulfite-treated DNA samples.
However, this technique is ineffective for CpG-rich sequences. For detection
and quantification of multiple CpG sites in a single assay, the method of
choice seems to be pyrosequencing of PCR-amplified, bisulfite-treated DNA
(Tost et al., 2003a, Dupont et al., 2004), while MALDI mass spectrometry
represents the latest, high-throughput technology for more demanding
projects (Tost et al., 2003b).
This chapter will illustrate the technical aspects of quantitative, real-time
PCR (qPCR) in studying de novo CpG methylation. In our analyses of several
genes related to the human immunodeficiency virus type 1 (HIV-1) infec-
tion and acquired immune deficiency syndrome (AIDS), the method
provides a rapid and cost-effective means of identifying samples with differ-
entially methylated CpG sites.
172 Real-time PCR
Table 10.1 Common, PCR-based techniques for quantitative analyses of CpG methylation, in
which bisulfite-treated DNA samples serve as the template
Technique Key features (advantages and References
disadvantages)
MSP: methylation-specific Simple, sensitive, but only one CpG (Herman et al., 1996)
PCR site at a time
COBRA: combined bisulfite Easy to use, accurate, but not all (Xiong and Laird, 1997)
restriction analysis CpGs are within restriction sites
BiPS: bisulfite PCR-single-strand Rapid, simple, but sensitivity is (Maekawa et al., 1999)
conformation polymorphism limited to small fragments
Methylight High-throughput, homogenous, (Eads et al., 2000)
and expensive
HeavyMethyl Sensitive, high-throughput, (Cottrell et al., 2004)
homogenous, and expensive
SNuPE: single nucleotide Rapid, but only one CpG site at (Gonzalgo and Jones,
primer extension a time 1997)
qPCR: real-time, quantitative PCR Medium- to high-throughput and (Lo et al., 1999,
requires special equipment Zeschnigk et al., 2004)
Direct sequencing of PCR Rapid, accurate, but quantification (Rakyan et al., 2004)
amplicons can be a problem for partially
methylated sites
Sequencing of cloned PCR Accurate, time-consuming, and Too many to list
amplicons expensive
Pyrosequencinga of PCR Rapid, accurate, inexpensive, short (Colella et al., 2003, Tost
amplicons reads per assay, and platform is et al., 2003a)
not widely available
MALDIb mass spectrometry Accurate, expensive, and platform (Tost et al., 2003b,
is not widely available Rakyan et al., 2004)
a
Detailed information can be found at: http://www.pyrosequencing.com/DynPage.aspx?id=7499.
b
MALDI, matrix-assisted laser desorption/ionization.
10.2 MDR1 (ABCB1, Gene ID 5243) as a primary target
locus
Officially known as ATP-binding cassette, sub-family B member 1 (ABCB1),
MDR1 (multidrug resistance protein 1) encodes a P-glycoprotein (GP170)
that has been studied extensively for its critical role as a drug transporter.
Up-regulation of MDR1 alters the kinetics of many therapeutic agents being
used for treating patients with cancer (Rund et al., 1999) and HIV-1 infec-
tion (Fellay et al., 2002). In both disease systems, enhanced efflux of intra-
cellular drugs have been associated with germline and somatic mutations at
the MDR1 locus. Uneven distribution of certain MDR1 variants in human
ethnic groups (Rund et al., 1999, Schaeffeler et al., 2001) may be further
responsible for the racial disparity in response to certain therapy. In
contrast, the influence of MDR1 promoter methylation on MDR1 function
is not so clear.
Quantitative analyses of DNA methylation 173
Table 10.2 Summary of qPCR-based tests of three MDR1 genomic regions (nucleotide
reference positions are based on GenBank sequence X58723).
Specifics Promoter fragment 1 Promoter fragment 2 Intron 1 fragment
(MDR1–PCR 1) (MDR1–PCR 2) (MDR1–PCR 3)
Forward primer positions nt. 768 > 790 nt. 888 > 907 nt. 1316 > 1336
Reverse primer positions nt. 888 < 907 nt. 1178 < 1193 nt. 1579 < 1598
Amplicon size 140 bp 308 bp 283 bp
GC content 43% 55% 66%
PCR annealing 60°C 60°C 60°C
temperature
Amplicon melting 80.5°C 88.5°C 90.0°C
temperature
CpG sites within 14 3 22
amplicon
EcoR I site (GAATTC) 0 0 0
BstU I site (CGCG) 1 0 6
qPCR standard curve a 1 log10Y = 7.75–0.29X log10Y = 7.81–0.27X log10Y = 7.60–0.26X
r2 for curve 1 0.992 0.994 0.994
qPCR standard curve a 2 log10Y = 7.85–0.30X log10Y = 7.56–0.26X log10Y = 7.89–0.28X
r2 for curve 2 0.998 0.990 0.998
a
For all standard curves, Y is the input DNA copy number in each reaction, while X is the threshold cycle (Ct)
number determined automatically by the iCycler® (BioRad).
Methylation at various CpG sites within a 1000-bp region (including
MDR1 exon 1 to exon 2) appears to regulate MDR1 gene expression
(Nakayama et al., 1998, Kusaba et al., 1999). Our ongoing studies of several
HIV/AIDS cohorts deal with both genetic and epigenetic characteristics of
the MDR1 gene, primarily because MDR1 is important to the metabolism of
HIV-1 protease inhibitors (Kim et al., 1998). The work described here aims
to define CpG methylation in the MDR1 promoter and intron 1 sequences.
10.3 Primer design
The MDR1 regions (promoter and intron 1) of interest are based on the
GenBank sequence X58723 (see Table 10.2 and Figure 10.1). For PCR and
related work (e.g. DNA sequencing), the primers are designed to meet six
criteria: a) amplicon size <400 bp, b) primer length ≥17 and ≤24 nucleotides,
c) primer to target melting temperature (Tm) ≥67°C and ≤71°C (by % GC
method), d) Tm for hairpin or homodimer <40°C, e) no apparent
heterodimer formation for paired (forward and reverse) primers, and f) no
close homology to other known sequences in the human genome. The first
four criteria are evaluated using the OligoTech program (Oligos Etc,
Wilsonville, Oregon), while the Entrez BLAST search is deemed sufficient in
confirming the correct annealing sites for each primer. The
oligonucelotides used are purchased from MWG Biotech, Inc. (High Point,
North Carolina), where full-length products are recovered following
standard HPSF purification, equivalent to reverse phase, high-performance
liquid chromatography (HPLC). Each lyophilized oligonucleotide is resus-
pended in TE80 (10 mM Tris-HCl, pH 8.0, 2 mM EDTA) as 0.5 mM stock. A
174 Real-time PCR
X Exon 1 XXXXXX
X = BstU I recognition site (5’ --CGCG-3’)
-
PCR 2 PCR 3
PCR 1
Figure 10.1
Schematic view (not drawn to exact scale) of qPCR-based analyses of MDR1
gene, which has several BstU I sites that can be analyzed for methylation status.
Solid and broken arrows indicate forward and reverse primers, respectively (see
Table 2). When BstU I-digested genomic DNA is used as the template, PCR 2
(308 bp) defines the total MDR1 copy number in each sample, while PCR 1
(140 bp) and PCR 3 (283 bp) qunatifies the methylated DNA copies resistant to
digestion by BstU I. The ratio of undigested DNA to total DNA reflects the
status of CpG methylation within the BstU I sites.
1:25 dilution in distilled, PCR-grade water makes the 20 μM working
solution for PCR.
10.4 Data evaluation: I. assay-to-assay variability
The reliability of qPCR assays was first evaluated by testing the same samples
repeatedly, at intervals ranging from one week to three months (see Figure
10.2). In 75 genomic DNA samples treated with EcoR I and BstU I, correlation
analyses were done in a subset of samples (n = 46–70) with methylation
levels >0.01 (other samples were treated as uninformative). For promoter
fragment 1 (n = 70 informative observations), MDR1 sequences with methy-
lated BstU I site accounted for 1% to 40% of the total DNA (see Figure 10.2A).
The results obtained from two separate experiments were highly consistent,
with a correlation coefficient (r) = 0.93 (P <0.001), regardless of certain differ-
ences (e.g. gender and the amount of input DNA) in the source materials
used for qPCR (adjusted r > 0.90, P <0.001). Results obtained from MDR1
intron 1 qPCR assays were similar (see Figure 10.2B), except that fewer
samples (n = 46) could be analyzed for assay-to-assay variability.
10.5 Data evaluation: II. MDR1 CpG methylation as
quantified by qPCR
As expected, CpG methylation levels within the BstU I sites did not fit into
a normal distribution (P ≤0.01 for all Kolmogorov–Smirnov normality
tests). For the 75 samples tested for promoter fragment 1 (MDR1–PCR 1),
the ratios of BstU I-resistant DNA to total input DNA ranged from 0.00 to
0.40, with an inter-quartile range of 3% to 9%, implying that the target
sequence is hypomethylated. Despite the suspicion that HIV-1 infection
can induce DNA methylation (Mikovits et al., 1998, Fang et al., 2001), strat-
ified analyses did not suggest that MDR1 methylation was elevated in HIV-
1 seropositive individuals (P >0.20). Results for the intron 1 region
Quantitative analyses of DNA methylation 175
F
Pearson r = 0.93, P < 0.001
M
0.4
0.3
Ratio (test 2)
0.2
0.1
0.0
0.0 0.1 0.2 0.3 0.4
M
F Pearson r = 0.93, P < 0.001
0.4
0.3
Ratio (test 2)
0.2
0.1
0.0
0.0 0.1 0.2 0.3 0.4
Ratio of BstU 1-resistant DNA to total DNA (test 1)
Figure 10.2
Close correlation of qPCR results obtained from different experiments. At
intervals ranging from one week to three months, genomic DNA samples (n =
75) treated with the methylation-sensitive endonuclease BstU I were tested twice
for the MDR1 promoter (panel a) and intron 1 (panel b) sequence, which has
one and six BstU I (CGCG) sites, respectively (see Table 2 for technical details).
Samples from females (F) and males (M) are labeled separately.
(inter-quartile range, 1% to 5%) are similiar, although the assay only
measured sequences in which all six BstU I sites are resistant to digestion.
Additional qPCR assays and pyrosequencing confirmed the hypomethyla-
tion status of multiple CpG sites at the MDR1 locus.
176 Real-time PCR
10.6 Expanded analyses
Using the same BstU I-digested genomic DNA samples, qPCR-based analyses
have been tested for several other genes, including leptin (LEP) and tumor
necrosis factor alpha (TNF). Except for the primers (designed to have similar
melting temperatures, with variation <3°C in any direction), qPCR proce-
dures are identical to the ones used for MDR1. While the results are still
considered preliminary and require further confirmation (e.g. by pyrose-
quencing and MS-PCR), an important conclusion can be drawn about the
comparison of various SYBR® Green qPCR kits: regardless of the gene
fragments of interest, the kits from Qiagen consistently produce reliable
(clean) amplicons without obvious primer-dimers. Similar kits from three
other suppliers either have reduced sensitivity (lower yield) or produce non-
specific amplicons (judged by amplicon size alone) clearly visible on agarose
gels stained with ethidium bromide.
For analyses of the MDR1 locus alone, experiments have been further
tested in EcoR I-digested gDNA samples treated with other methylation-
sensitive DNA endonucleases, including Aci I (CCGC), HpaII (CCGG), Taq I
(ACGT), and Xho I (CTCGAG). Other sequences containing any of these
sites are also suitable for qPCR-based screening.
Overall, rapid and cost-effective qPCR assays as tested here have at least
two major advantages for identifying sequences with differential CpG
methylation. First, the tests are quantitative, with highly reproducible
results. Second, compared with bisufite-treated, single-stranded DNA
samples required for other assays (e.g. MSP and pyrosequencing), the DNA
templates treated with methylation-sensitive endonucleases remain double-
stranded and can be stored at 4°C for extended and repeated tests. For most
conclusive analyses, we recommend qPCR-based screening followed by
confirmation with pyrosequencing.
Acknowledgments
This work was supported by a grant (R01 AI51173) from National Institute
of Allergy and Infectious Diseases (NIAID). We thank Tarig Hagazi and
Thomas R. Unnasch for technical advice; Chengbin Wang and Yufeng Li for
statistical analyses; and Jeffery Edberg for supervision of work related to
pyrosequencing.
References
Colella S, Shen L, Baggerly KA, Issa JP, Krahe R (2003) Sensitive and quantitative univer-
sal Pyrosequencing methylation analysis of CpG sites. Biotechniques 35: 146–150.
Cottrell SE, Distler J, Goodman NS, Mooney SH, Kluth A, Olek A, Schwope I, Tetzner
R, Ziebarth, H, Berlin K (2004) A real-time PCR assay for DNA-methylation using
methylation-specific blockers. Nucleic Acids Res 32: e10.
Dupont JM, Tost J, Jammes H, Gut IG (2004) De novo quantitative bisulfite sequenc-
ing using the pyrosequencing technology. Anal Biochem 333: 119–127.
Eads CA, Danenberg KD, Kawakami K, Saltz LB, Blake C, Shibata D, Danenberg PV,
Laird PW (2000) MethyLight: a high-throughput assay to measure DNA methy-
lation. Nucleic Acids Res 28: E32.
Quantitative analyses of DNA methylation 177
Fang JY, Mikovits JA, Bagni R, Petrow-Sadowski CL, Ruscetti FW (2001) Infection of
lymphoid cells by integration-defective human immunodeficiency virus type 1
increases de novo methylation. J Virol 75: 9753–9761.
Feinberg AP, Cui H, Ohlsson R (2002) DNA methylation and genomic imprinting:
insights from cancer into epigenetic mechanisms. Semin Cancer Biol 12:
389–398.
Fellay J, Marzolini C, Meaden ER, Back DJ, Buclin T, Chavel J-P, Decosterd LA, Furrer
H, Opravil M, Pantaleo G, Retelska D, Ruiz L, Schinkel A, Vernazza P, Eap CB,
Telenti A, for the Swiss HIV Cohort Study (2002) Response to antiretroviral
treatment in HIV-1-infected individuals with allelic variants of the multidrug
resistance transporter 1: a pharmacogenetics study. Lancet 359: 30–36.
Fitzpatrick DR, Wilson CB (2003) Methylation and demethylation in the regulation
of genes, cells, and responses in the immune system. Clin Immunol 109: 37–45.
Geisler JP, Manahan KJ, Geisler HE (2004) Evaluation of DNA methylation in the
human genome: why examine it and what method to use. Eur J Gynaecol Oncol
25: 19–24.
Gonzalgo ML, Jones PA (1997) Rapid quantitation of methylation differences at
specific sites using methylation-sensitive single nucleotide primer extension
(Ms-SNuPE). Nucleic Acids Res 25: 2529–2531.
Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB (1996) Methylation-specific
PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci
USA 93: 9821–9826.
Kim RB, Fromm MF, Wandel C, Leake B, Wood AJ, Roden DM, Wilkinson GR (1998)
The drug transporter P-glycoprotein limits oral absorption and brain entry of
HIV-1 protease inhibitors. J Clin Invest 101: 289–294.
Kusaba H, Nakayama M, Harada T, Nomoto M, Kohno K, Kuwano M, Wada M (1999)
Association of 5’ CpG demethylation and altered chromatin structure in the
promoter region with transcriptional activation of the multidrug resistance 1
gene in human cancer cells. Eur J Biochem 262: 924–932.
Lo YM, Wong IH, Zhang J, Tein MS, Ng MH, Hjelm NM (1999) Quantitative analysis
of aberrant p16 methylation using real-time quantitative methylation-specific
polymerase chain reaction. Cancer Res 59: 3899–3903.
Maekawa M, Sugano K, Kashiwabara H, Ushiama M, Fujita S, Yoshimori M, Kakizoe
T (1999) DNA methylation analysis using bisulfite treatment and PCR-single-
strand conformation polymorphism in colorectal cancer showing microsatellite
instability. Biochem Biophys Res Commun 262: 671–676.
Mikovits JA, Young HA, Vertino P, Issa JP, Pitha PM, Turcoski-Corrales S, Taub DD,
Petrow CL, Baylin SB, Ruscetti FW (1998) Infection with human immunodefi-
ciency virus type 1 upregulates DNA methyltransferase, resulting in de novo
methylation of the gamma interferon (IFN-gamma) promoter and subsequent
downregulation of IFN-gamma production. Mol Cell Biol 18: 5166–5177.
Muegge K, Young H, Ruscetti F, Mikovits J (2003) Epigenetic control during
lymphoid development and immune responses: aberrant regulation, viruses,
and cancer. Ann N Y Acad Sci 983: 55–70.
Nakayama M, Wada M, Harada T, Nagayama J, Kusaba H, Ohshima K, Kozuru M,
Komatsu H, Ueda R, Kuwano M (1998) Hypomethylation status of CpG sites at
the promoter region and overexpression of the human MDR1 gene in acute
myeloid leukemias. Blood 92: 4296–4307.
Rakyan VK, Hildmann T, Novik KL, Lewin J, Tost J, Cox AV, Andrews TD, Howe KL,
Otto T, Olek A, Fischer J, Gut IG, Berlin K, Beck S (2004) DNA methylation
profiling of the human major histocompatibility complex: a pilot study for the
human epigenome project. PLoS Biol 2: e405.
Robertson KD, Wolffe AP (2000) DNA methylation in health and disease. Nat Rev
Genet 1: 11–19.
178 Real-time PCR
Rund D, Azar I, Shperling O (1999) A mutation in the promoter of the multidrug
resistance gene (MDR1) in human hematological malignancies may contribute
to the pathogenesis of resistant disease. Adv Exp Med Biol 457: 71–75.
Schaeffeler E, Eichelbaum M, Brinkmann U, Penger A, Asante-Poku S, Zanger, UM,
Schwab M (2001) Frequency of C3435T polymorphism of MDR1 gene in African
people. Lancet 358: 383–384.
Shao W, Tang J, Dorak MT, Song W, Lobashevsky E, Cobbs CS, Wrensch MR, Kaslow
RA (2004) Molecular typing of human leukocyte antigen and related polymor-
phisms following whole genome amplification. Tissue Antigens 64: 286–292.
Tang J, Wilson CM, Meleth S, Myracle A, Lobashevsky E, Mulligan MJ, Douglas SD,
Korber B, Vermund SH, Kaslow RA (2002) Host genetic profiles predict viro-
logical and immunological control of HIV-1 infection in adolescents. AIDS 16:
2275–2284.
Tost J, Dunker J, Gut IG (2003a) Analysis and quantification of multiple methylation
variable positions in CpG islands by Pyrosequencing. BioTechniques 35: 152–156.
Tost J, Schatz P, Schuster M, Berlin K, Gut IG (2003b) Analysis and accurate quantifi-
cation of CpG methylation by MALDI mass spectrometry. Nucleic Acids Res 31:
e50.
Xiong Z, Laird PW (1997) COBRA: a sensitive and quantitative DNA methylation
assay. Nucleic Acids Res 25: 2532–2534.
Zeschnigk M, Bohringer S, Price EA, Onadim Z, Masshofer L, Lohmann DR (2004) A
novel real-time PCR assay for quantitative analysis of methylated alleles
(QAMA): analysis of the retinoblastoma locus. Nucleic Acids Res 32: e125.
See also Tooke N and Pettersson M (2004): http://www.devicelink.com/ivdt/archive/
04/11/002.html
Quantitative analyses of DNA methylation 179
Protocol 10.1
Genomic DNA samples 1a. Cell line DNA – as a source of external
reference material, several genomic DNA
samples (e.g. KT17) established for the 10th
International Histocompatibility Workshops
were purchased from Fred Hutchinson
Cancer Research Center (Shao et al., 2004).
The pre-determined concentration of 200
ng/μL corresponds to ~28,571 genome
copies/μL
1b. Patient DNA samples – these samples were
extracted from whole blood using the
QIAamp DNA Blood Mini kit (Qiagen) (Tang
et al., 2002); DNA concentration was initially
estimated by optical density at 260 nm; more
reliable quantification was done using the
PicoGreen dsDNA Assay (Molecular Probes)
that stains double-stranded DNA
Digestion of gDNA 2a. EcoR I reaction mix (60 μL each)
with EcoR I (New 10x NE buffer H 6.0 μL
England Biolabs) EcoR I (10 U/μL) 0.5 μL
gDNA (~300 ng/μL) 20.0 μL
Sterile water 33.5 μL
2b. Incubate sample at 37°C for 4 hr before
inactivating enzyme at 65°C for 20 min (best
done in a thermocycler with heated lid)
2c. Separate EcoR I-digested gDNA from salt and
enzyme by size exclusion, using 96-well filter
plate (Millipore) attached to a manifold
vacuum
2d. Recover EcoR I-digested gDNA in 120 μl
sterile water. The digested DNA is enough for
many downstream applications; with an
estimated 95% recovery rate, DNA concen-
tration becomes ~45 ng/μL
Digestion of gDNA 3a. BstU I reaction mix (40 μL each)
with BstU I (New 10x NE buffer 2 4.0 μL
England Biolabs) BstU I (10 U/μL) 0.5 μL
EcoR I-treated gDNA 20.0 μL
(~45 ng/μL) (one-sixth of the total)
Sterile water 15.5 μL
180 Real-time PCR
3b. Incubate sample at 60°C for 2 hr
3c. Separate BstU I-digested gDNA from salt and
enzyme by size exclusion, using 96-well filter
plate (Millipore) attached to a manifold
vacuum
3d. Recover BstU I-digested gDNA in 120 μl sterile
water for qPCR (DNA concentration becomes
~7 ng/μL)
qPCR in 96-well plates 4a. Prepare qPCR reaction mixture, with each
having a total volume of 25 μL:
2x QuantiTect master mix 12.5 μL
(Qiagen)*
Forward primer (20 μM) 0.5 μL
Reverse primer (20 μM) 0.5 μL
100x fluorescein 0.25 μL
BstU I-digested gDNA 1.0 μL (~7 ng)
PCR water 10.25 μL
*Reagents from several other suppliers do not
work consistently without further optimiza-
tion
4b. Thermocycling in the iCycler® (with heated
lid) (BioRad)
Step 1. 95°C, 15 min (to active the
HotStarTaq)
Step 2. 35 cycles of 95°C for 20 sec (denatur-
ing), 60°C (annealing, temperature decreas-
ing at 0.2°C per cycle until it reached 58°C)
for 30 sec, 72°C for 36 sec (extension), with
optics activated after each extension,
Step 3. Plot melting curve from 65°C to 95°C
4c. Characterization of qPCR amplicon (optional)
by conventional techniques including
• Run PCR products on 2.0% agarose gel to
visualize DNA bands (with ethidium
bromide staining and UV transillumination)
• Determine the size of qPCR amplicons by
comparing with bands in the 100-bp DNA
ladder (New England Biolabs)
• Confirm the DNA sequence identity by
nested PCR, Southern blot, or direct cycle
sequencing
Design and 5a. For each experiment, the first 10 wells are
documentation of reserved for duplicates of five serially diluted
qPCR assays (e.g. 1:8, 1:64, 1:512, and 1:4096), positive
control DNA (high molecular weight
Quantitative analyses of DNA methylation 181
genomic DNA or plasmid DNA containing
the target sequence) with a known copy
number. Other wells are used for testing
samples (also in duplicates)
5b. Verify that each qPCR test yields specific
amplicons (e.g. 4c) and that all melting
curves overlap to form a single peak; qPCR
assays containing an internal probe (e.g.
TaqMan® ) should be used if these conditions
are not met
5c. Use the threshold cycle numbers (Ct) of
control samples to generate a standard curve
in each test, with known input DNA copy
numbers transformed to log10 (e.g. Table 2);
experiments are deemed reliable if the r2 for
the standard curve is greater than 0.95
5d. With DNA samples treated with EcoR I and
BstU I, qPCR for MDR1 promoter fragment 2
(no EcoR I site; no BstU I site) was used to
quantify the total input DNA copy numbers in
each sample (see Figure 10.1)
5e. qPCR for MDR1 promoter fragment 1 (no
EcoR I site; 1 BstU I site) and MDR1 intron 1
(no EcoR I site; 6 BstU I sites) defined the DNA
copies resistant to BstU I (due to CpG methy-
lation)
5f. The ratio of BstU I-resistant MDR1 DNA to
total input DNA serves as a crude measure
(see discussion in the text and Figure 10.1) of
methylation level in test samples
6. Verification of CpG 6a. Design PCR and sequencing primers using
methylation by the Pyrosequencing™ Assay Design
pyrosequencing Software
6b. Treat gDNA samples with bisulfite to convert
unmethylated cytosine to uracil (U), following
procedures outlined for the EZ DNA methyla-
tion kit (Zymo Research)
6c. Perform pyrosequencing using the Pyro Gold
reagents, as recommended by the manufac-
turer (Biotage); proportion of methylcytosine
(mC) is calculated automatically in the allele
frequency mode
Mitochondrial DNA
analysis
Steve E. Durham and Patrick F. Chinnery
11
11.1 Introduction
The field of mitochondrial genetic research is an emerging and rapidly
expanding area of interest. A recent OVID (Medline) search revealed 300
references between 1975–1979 citing mitochondria as a keyword in some
format (mitochondria, mitochondrial or mtDNA), but by 2000–2004 this
number has increased to 14,000. Mitochondria are essential intracellular
organelles that are the primary source of adenosine triphosphate (ATP), the
high energy molecule required for all active intracellular processes. ATP is
generated by oxidative phosphorylation which is carried out by the respira-
tory chain on the inner mitochondrial membrane. The respiratory chain is
composed from over 100 different polypeptides, making up five enzyme
complexes, some of which are synthesized within the mitochondria from
their own DNA (the mitochondrial genome, mtDNA). In addition to their
fundamental role in energy metabolism, mitochondria are involved in
intracellular calcium signaling and apoptosis. It therefore comes as no
surprise that diverse disciplines have developed an interest in mitochon-
dria, from inherited neurological disorders to cancer and the ageing process.
The mtDNA molecule forms the focus of this chapter.
11.2 Mitochondrial genetics
mtDNA is the only source of DNA outside the nucleus in mammals and has
a number of distinct properties. The human mitochondrial genome is a
double-stranded circular DNA molecule, 16,569 bp in length, accounting
for approximately 1% of total cellular DNA. The complete sequence was
determined in 1981 (Anderson et al., 1981) (Cambridge Reference Sequence
– CRS) and was re-sequenced in 1999 (Andrews et al., 1999) enabling the
correction of some sequence errors and common polymorphic variants. The
revised Cambridge Reference Sequence (rCRS) is available through the
MITOMAP web site (MITOMAP, 2005). Expression of almost the complete
genome is required for respiratory chain function, in comparison to only
7% of the nuclear genome being expressed at any one time. mtDNA has a
different codon usage, is strictly maternally inherited and undergoes little if
any intermolecular recombination. mtDNA encodes 37 genes; 13 essential
polypeptides of the mitochondrial respiratory chain as well as 22 transfer
RNA (tRNA) and 2 ribosomal RNA (rRNA) genes (Figure 11.1) that are
184 Real-time PCR
OH
PH
12s F T
RNA Cyt b
D-Loop
V
P
16s PH
RNA
E
ND6
L
ND5
ND1
I Q L
M S
H
ND2
AN
OL ND4
W C
Y
ND4L
R
S ND3
G
CO1
CO3
D K ATPase6
CO2 ATPase8
Complex I genes – NADH dehydrogenase
Complex III genes – ubiquinol cytochrome c oxidoreductase
Complex IV genes – ATP synthase
Complex V genes – ATP synthase
Transfer RNA genes
Ribosomal RNA genes
Noncoding displacement loop
Figure 11.1
Sequence arrangement of the human mitochondrial genome. Genes are coded
as the differently shaded inset. OH and OL are the origins of replication for the
heavy and light strands respectively. PH and PL are the promoters for the heavy
and light strands respectively.
essential for intra-mitochondrial translation and transcription. The
mitochondrial genome contains no introns and is so compact that there are
regions of gene overlap. The displacement loop (D-loop), approximately
1.1 kb in length, is not directly involved in protein synthesis but plays a
crucial role in regulating translation and transcription of the mtDNA
molecule.
Mitochondrial DNA analysis 185
11.2.1 mtDNA mutations
Mutations of mtDNA can be present as large-scale rearrangements
(deletions or duplications) and point mutations. Small deletions and inver-
sions have been described but these are rare and will not be considered
further. Duplications are not considered pathogenic, although they may
predispose to deletion formation. Many point mutations do not alter the
corresponding protein sequence or have no demonstrable phenotypic effect
but some do cause a defect of the respiratory chain. This is either through a
direct effect on a structural subunit, or indirectly through an effect on intra-
mitochondrial protein synthesis. Similar effects are seen from most large-
scale deletions as they often affect both structural subunits and protein
synthesis.
11.2.2 mtDNA copy number and heteroplasmy
Multiple copies of the mitochondrial genome can be found in individual
mitochondria, with many mitochondria present in a single cell. The precise
number of genomes per mitochondrion is unknown and is likely to vary
between cell types; the generally accepted range is between 2 to 10
molecules per organelle. The number of mitochondria per cell is dependent
on the metabolic demands of that cell type and can vary from 100s to
10,000s. In most individuals at birth, all of the mtDNA molecules are identi-
cal (called homoplasmy). However, the presence of mutated mtDNA usually
generates a mixture of wild-type and mutated molecules within the same
cell. This phenomenon is referred to as heteroplasmy. The percentage level
of mutated mtDNA often varies from cell to cell, and from organ to organ
within an individual and may change over time.
11.2.3 The threshold effect
Single-cell and cybrid (cytoplasmic hybrid) studies have shown that the
proportion of mutated mtDNA is directly related to the expression of a
biochemical defect within the cell. There is a critical ratio between wild-
type and mutant mtDNA that must be exceeded before phenotypic expres-
sion of the disease occurs. For the majority of mtDNA mutations this
percentage mutation load threshold correlates with the histochemically
demonstratable activity of cytochrome c oxidase (COX, complex IV of the
respiratory chain). Above the mutation threshold cells appear COX
negative, while at lower mutation loads COX activity can still be demon-
strated. The threshold level is variable and dependent on the type of
mutation and its location, with some tRNA mutations requiring 85%
mutant mtDNA while some protein coding mutations and deletions can
express a mutant phenotype at much lower levels. Although the percentage
level of mutated mtDNA appears to be important, for most mutations it is
not clear whether the respiratory chain defect is actually due to the ratio of
mutated to wild-type mtDNA, or related to the absolute amount of wild-
type mtDNA (analogous to haplo-insuffiency), or mutated mtDNA (through
a dominant negative effect).
186 Real-time PCR
11.2.4 Mutation rate of mtDNA
The mutation rate of the mitochondrial genome is estimated as being some
ten times faster than that of the nuclear genome. The high mutation rate
seen with mtDNA is likely to be caused by a cumulative effect of the high
levels of reactive oxygen species (ROS), the absence of histones and the
limited DNA repair mechanisms available. This has three major conse-
quences; 1) mtDNA has accumulated mutations throughout evolution,
leading to many polymorphic differences between unrelated individuals; 2)
mtDNA mutations are a relatively common cause of sporadic and inherited
human disease; and 3) mtDNA accumulates somatic mutations throughout
human life.
11.2.5 Mitochondrial DNA, ageing and disease
Ageing
Histochemical studies have shown that a small proportion of non-dividing
cells from healthy humans acquire a respiratory chain defect throughout
life. Single-cell studies have identified pathogenic mutations of mtDNA
within the majority of these cells, explaining the accumulation of poten-
tially pathogenic mtDNA mutations with age in many human tissues
(Michikawa et al., 1999b; Attardi, 2002; Fayet et al., 2002). Both point
mutations and deletions have been detected, but deletions appear to be the
most common cause of age-related COX deficiency. The majority of mtDNA
deletions appear to occur between sites of direct DNA sequence repeats of 4
to 15 bp. This suggests that the mechanism by which deletions occur is by
slippage during replication or by homologous recombination. The majority
of deletions are found on the major arc of the mitochondrial genome, a
region defined as being between the origin of light strand replication (OL)
and the origin of heavy strand replication (OH). Approximately 95% of
reported deletions occur in this region and remove genes encoding subunits
of COX, ATP synthase and NADH dehydrogenase. The first mtDNA deletion
reported to accumulate with age was a deletion of 4,977 bp. The so-called
‘common deletion’ occurs between two 13 bp repeat sites, at nucleotide
positions 8,470 to 8,483 and 13,447 to 13,459, removing approximately
5 kb of mtDNA between the ATPase8 and ND5 genes. In accordance with
the MITOMAP website, all base positions are numbered from the light
strand (L strand). Table 11.1 lists some of the mtDNA mutations associated
with ageing.
Primary mitochondrial DNA diseases
Primary mitochondrial diseases are those caused by a mutation, either a
point mutation or deletion, in the mitochondrial genome. Mitochondrial
disease is a term which covers a broad spectrum of multi-systemic disorders.
The pathogenic mutations compromise respiratory chain function leading
to cellular dysfunction and ultimately cell death. Table 11.2 summarizes
some of the more common mtDNA disorders.
Mitochondrial DNA analysis 187
Table 11.1 Examples of mtDNA deletions and base substitutions which have been reported
at higher prevalences in healthy aged individuals with the tissues each has been seen in.
Deletion start and end points are shown. CSB2 – Conserved Sequence Block 2; OH and OL -
origins of replication for the heavy and light strand respectively; PH and PL – promoters for
heavy and light strand respectively.
Mutation Location Affected tissue
mtDNA deletions
4977 bp 8468 to 13446 Heart, liver, brain, skeletal muscle and other tissues
6063 bp 7842 to 13905 Liver
7400 bp 8648 to 16085 Myocardium, brain cortex and putamen
3895 bp 548 to 4442 Skeletal muscle
Multiple deletions Various Various
mtDNA point mutations
8344A>G tRNALys Extraocular muscle
3243A>G tRNALeu(UUR) Extraocular muscle
4460T>C, tRNAMet Skeletal muscle
4421G>A tRNAMet Skeletal muscle
Cins 310 D-Loop (CSB2) Skin fibroblasts
414T>G D-Loop (PL) Skin fibroblasts
189A>G D-Loop (OH) Skeletal muscle
408T>A D-Loop (PL) Skeletal muscle
150C>T D-Loop (OH) Leukocytes
Table 11.2 Common mitochondrial disorders and associated mtDNA mutations.
Disorder Clinical features mtDNA
mutation
Chronic Progressive External External ophthalmoplegia and Large Scale
Ophthalmoplegia (CPEO) bilateral ptosis deletions or
Kearns Sayre Syndrome (KSS) Early PEO onset (<20 yrs) with pigmentary duplications
retinopathy with one of; elevated CSF,
cerebellar ataxia and heart block
Pearson Syndrome (PS) Sideroblastic anemia in childhood, pan-
cytopenia and exocrine pancreatic failure
Lebers Hereditary Optic Subacute painless bilateral loss of vision, 3460G>A
Neuropathy (LHON) onset ~20 yrs. Male affected bias 11778G>A
14484T>C
Neurogenic weakness with Early adult/late childhood onset peripheral 8993T>G/C
ataxia and retinitis pigmentosa neuropathy with ataxia and pigmentary
(NARP) retinopathy
Mitochondrial encephalomyopathy Stroke like episodes, onset <40 yrs. 3243A>G
with lactic acidosis and stroke-like Seizures, dementia, ragged red fibers and 3251A>G
episodes (MELAS) lactic acidosis 3271T>C
Myoclonic epilepsy with ragged Myoclonus, seizures, cerebellar ataxia and 8344A>G
red fibers (MERRF) myopathy 8356T>C
Leigh Syndrome (LS) Subacute relapsing encephalopathy with 8993T>G/C
cerebellar and brain stem signs, onset in
infancy
Non-syndromic sensorineural deafness 7445A>G
Aminoglycoside induced 1555A>G
non-syndromic deafness
188 Real-time PCR
mtDNA point mutations
Designing as assay for the detection of mtDNA point mutations is, in
essence, no different to detecting nDNA mutations by allelic discrimination.
Examples of allelic discrimination assays are presented in Chapters 8, 9, and
17 and will not be repeated here. The major difference is that when measur-
ing nuclear alleles the percentage values are either 50% heterozygous or
100% homozygous. When measuring the mutant load in the mtDNA, values
of heteroplasmy from 1 to 99% can be present. These need to be accurately
measured when investigating a pathogenic point mutation, e.g. 8344A>G
(Szuhai et al., 2001), as the level of heteroplasmy has important implications
on the clinical phenotype and disease progression. Validation across the full
range of heteroplasmy values is required to enable meaningful data to be
obtained from the assay and for valid conclusions to be drawn.
Nuclear mitochondrial disorders
Nuclear mitochondrial disorders are those conditions where the primary
genetic defect is encoded on the nuclear genome but the effect of this defect
is realized in mitochondria (Spinazzola and Zeviani, 2005). This effect is
either directly on mtDNA maintenance or on mitochondrial processes, e.g.
OXPHOS and protein import. Some examples of these disorders where the
effect is on the mtDNA are shown in Table 11.3. When considering real-
time PCR for these nuclear mutations the primary genetic defect is either
homozygous or heterozygous, so quantification of the mutant load is
unnecessary. Detection of the presence of the nuclear mutation can be
easily achieved by another means, e.g. sequencing, RFLP, primer extension
assays. It is the secondary defect of the mtDNA which is of relevance here,
be it the level of heteroplasmy (point mutations or deletions, single or
multiple) or the absolute quantity of mtDNA (depletion).
mtDNA mutations and cancer
mtDNA substitutions have been detected in a number of different human
cancers (Penta et al., 2001). It is currently unclear whether these mutations are
a secondary phenomenon, and are of no direct relevance to carcinogenesis, or
whether they are primarily involved in the disease (Coller et al., 2001). In
Table 11.3 Nuclear-mitochondrial disorders where the primary genetic defect is on the
nuclear genome and results in a secondary mtDNA genetic defect.
Disorder Nuclear defect mtDNA mutation
Autosomal dominant PEO Adenine Nucleotide Translocator (ANT1) Multiple mtDNA
mtDNA polymerase γ (POLG) deletions
Twinkle helicase (C10orf2)
Mitochondrial neuro-gastrointestinal Thymidine Phosphorylase (TP)
encephalomyopathy
Myopathy with mtDNA depletion Thymidine Kinase (TK2) mtDNA depletion
Myopathy with hepatic failure Deoxyguanosine Kinase (DGOUK)
Mitochondrial DNA analysis 189
most cases the mutations are homoplasmic (i.e. all of the mtDNA is mutated
within individual cells). Each tumor contains a specific point mutation (or
mutations), and allele detection is usually achieved by sequencing.
Toxin-induced mtDNA depletion
Shortly after the introduction of nucleoside analogue treatment for
acquired immunodeficiency due to HIV infection, it became clear that some
patients receiving AZT (azydothymidine) developed a mitochondrial
myopathy due to mtDNA depletion. mtDNA is replicated by pol γ, which is
inhibited by a variety of nucleoside analogues (part of the HAART, or highly
active anti-retroviral therapy regime) (Lewis et al., 2003). Acute and
subacute nucleoside toxicity can be life-threatening, due to the lactic acido-
sis and liver failure. A number of studies have described mtDNA depletion
in peripheral blood immediately preceding the clinical deterioration,
raising the possibility that measuring mtDNA levels (relative to a single
copy nuclear gene), might be used to monitor therapy and prevent fatal
complications (de Mendoza et al., 2004) or the more chronic complications
such as lipodystrophy (McComsey et al., 2005b). However, not all studies
are in agreement, and it may be necessary to study a specific group of blood
monocytes to gain clinically useful data (Hoy et al., 2004). Moreover, with
the advent of new generation therapies, nucleoside toxicity is less of a
problem (Lewis et al., 2003; McComsey et al., 2005a). This chapter will not
discuss mtDNA assays in HAART in greater detail, but the basic principle of
measuring mtDNA copy number will be considered in greater depth and has
broad applications across this and other disciplines.
11.3 Mitochondrial DNA analysis by real-time PCR
The focus of this chapter is the detection and quantification of mtDNA
deletions and the measurement of total mtDNA copy number in individual
cells. We will cover some of the considerations required when measuring
changes in mtDNA copy number from tissue homogenate samples, or blood
extractions where mtDNA:nDNA assays are required.
11.3.1 Detection method
Each real-time system differs in its configuration, however they are all
similar in so much as they detect emitted fluorescence for each reaction
from the specific fluorophore(s) being used. For the purpose of this discus-
sion we will simply be referring to two methods, DNA binding dyes and
probes. We are aware that there are subgroups within these categories but
they are discussed elsewhere in detail in this book. For detailed guidance on
the selection of an appropriate detection method (binding dye or probe) the
reader is referred to the relevant chapters of this book.
11.3.2 Oligonucleotide fluorescent probes
We appreciate that there are a variety of different types of probe technolo-
gies available to the investigator. Detailed information of the different
190 Real-time PCR
probes can be found in Chapters 1 and 5. For the purpose of this chapter we
will simply refer to all types of them under the umbrella term ‘probes.’
Probes have two major advantages over DNA binding dyes. First they add
an extra layer of specificity to a reaction. The correct binding of both
primers and the probe are required to generate a signal. This combination of
primer/probe binding makes it less likely to generate a signal from a non-
specific product or from misannealing.
Second, probes facilitate multiplex reactions. Oligonucleotide probes can
be labeled with fluorophores which emit at different wavelengths, this
means different probes can be used to detect multiple targets within a single
reaction tube. Using the machines currently available it is possible to
perform a four color multiplex. It should be noted however, that the
optimization required to perform this is extensive and expensive for both
time and reagents. A large proportion of the genetic analysis performed in
the mitochondrial field is carried out at the single-cell level, limiting DNA
quantity, pressing the investigator into detecting several targets in a single
reaction.
11.3.3 DNA binding dyes
SYBR Green® is the DNA binding dye most commonly used in real-time PCR
applications. Chapters 1, 7, 8, and 9 all contain reviews and comparisons of
this technology to others available and again, the reader is directed to these
chapters for detailed information.
DNA binding dyes are molecules which bind non-specifically to double-
stranded DNA molecules. This includes specific products, misprimed non-
specific products and primer-dimer molecules. Due to this non-specific
binding, amplicon selection and primer design are of utmost importance
with this technology. Self–self primer binding, dimer formation and loop
structures can all introduce non-specific signal. DNA binding dye techno-
logy allows the investigator to view the number of products contributing to
the observed fluorescent signal. This is achieved by the gradual increase of
the temperature, post-amplification, causing the amplicon to dissociate to
become single-stranded. As this occurs, the DNA binding dye is released and
the fluorescence signal decreases. Based on the DNA sequence of the
amplicon there is a specific temperature at which it will be completely
dissociated. However, as different regions of the amplified product
will dissociate at different temperatures before the whole product is single-
stranded, this means there will be a graded decrease in fluorescence.
Software packages translate this data into a ‘melting curve’, represented as
a single peak per product in the negative first-derivative curve of the
actual melting curve. As informative as this is, when first setting up a
method the melting curve data should not be relied on alone for determin-
ing whether you have a single product or not. The nature of the melting
curve means that the product peaks are broad. It is very possible that this
could mask the presence of secondary products not that dissimilar in length
or thermal profile. The degree to which this problem presents itself is
dependent on the melting curve parameters. All primer pairs should be
checked for specificity by separating the amplification products through a
high percentage agarose gel.
Mitochondrial DNA analysis 191
11.3.4 Considerations when designing a mtDNA real-time assay
Primer and probe design
The presence of mitochondrial DNA pseudogenes in the nuclear genome
has implications for primer and probe design. Approximately 0.016% of the
nuclear genome is nonfunctional mitochondrial DNA (Woischnik and
Moraes, 2002). This issue is more pronounced with real-time PCR
amplicons as they are short in length and this increases the possibility of
pseudogenic amplification. To ensure that the primers you have designed
are amplifying a product of genuine mitochondrial amplification it is useful
not only to check that the primers do not anneal to the nuclear genome by
in silico methods (using BLAST) but to also amplify extracted DNA from
rho0 cells. Rho0 cells are devoid of mtDNA therefore no amplification
products should be seen.
There are specific features of mtDNA which can interfere with assay
design. Strand asymmetry, the uneven distribution of purine and pyrimi-
dine nucleotides across the heavy and light strands can give rise to large
regions with undesirable primer characteristics. The presence of C-tract
length variants and the highly polymorphic nature of the D-loop, make this
region particularly difficult for robust assay design. It is suggested that
investigators avoid this region unless they have good D-loop characteriza-
tion for the cohort of samples they are investigating and are aware of these
variations. Web based systems, such as MFold (Zuker, 2003), determine the
three dimensional structure of a target DNA sequence. By understanding
the structure of the region of interest, primers can be selectively placed in
accessible locations. As with any PCR based assay, good primer design
initially will save time and money in the long term.
Primer and probe design is covered by Wang and Seed in Chapter 5 of this
book with additional considerations given in Chapter 7. The considerations
when designing a mtDNA assay are the same as those required when design-
ing any real-time assay. Most real-time PCR machines are supplied with
primer design software in some format, however there are good programs
freely available on the web to aid in amplicon selection.
When designing primers for a DNA binding dye real-time reaction the
investigator can apply the same design parameters as for any normal PCR
reaction. Amplicon size is less restrictive with binding dye reactions as the
polymerase does not have to displace a probe. Amplicons in the size range
100 bp to 250 bp can be readily amplified using short, two step amplifica-
tion protocols (denaturing then combined annealing/extension) with no
visible effect on efficiency. With longer amplicons it may be necessary to
resort to three step PCR amplification (denaturing, annealing and then
extension). Wherever possible primers should be selected which have no
self binding, loop or dimer formation. Where this is not possible we suggest
that primers with dG binding values greater than –2 kCal/mol are avoided.
From experience, primers adhering to this restriction give more repro-
ducible results.
In probe-based assays the polymerase uses its 5’ endonuclease activity to
displace a bound probe, this slows the extension of the amplicon. It is with
that in mind that probe based assays are not recommended to exceed
192 Real-time PCR
150 bp, amplicons of less than 100 bp are recommended. Restrictions on
primer design follow similar parameters to those applied to primers for
SYBR® Green assays. These criteria should also be applied to the probe,
ensuring that no binding occurs between either primer or the probe.
When designing multiplex reactions the consideration of primer/probe
interaction becomes of greater importance. For example, in a singleplex
TaqMan® probe reaction there are three oligonucleotides that can interact
with each other. With a four color multiplex there are now 12 oligonu-
cleotides to optimize in the same reaction, posing a particular challenge
during assay development.
Amplicon selection
When looking at a mtDNA assay, the choice of target and/or control region
will vary depending on the questions being asked by the investigator and by
the origin of the DNA samples. One of the unique problems encountered
when analyzing mtDNA is the presence of so many different reported DNA
deletions. When designing the assay, it is important to bear in mind that
mtDNA deletions accumulate with age, and that some deletion species are
found more prevalently in some tissue types than others. What has been used
as a reference target in one study may not necessarily work as a reference in a
different tissue or patient population. The distribution of mtDNA deletions
around the genome can be seen in Figure 11.2. The data have been taken from
the MITOMAP web site (MITOMAP, 2005) and only deletions with reported
breakpoints have been included. It can be clearly seen that the only region
free from deletions is the D-loop. mtDNA species with deleted D-loop regions
do not appear to persist in cells, most likely due to the removal of the regula-
tory regions preventing accumulation to detectable levels. It should be noted
the D-loop is highly polymorphic and, although free from deletions, it is
therefore not be the best choice as a reference region for an assay.
Quantification of mtDNA deletions
When investigating mtDNA deletions there are two major approaches. The
first will allow the measurement of the total mutation load in a sample,
whereas the second is mtDNA deletion specific. The difference arises from
the selection of amplicons. Both approaches require the selection of a
control region which is not deleted in the cohort of samples under investi-
gation. With the first approach the second amplicon is situated within the
region deleted. This allows the measurement of wild-type mtDNA, enabling
calculation of the total mutant load present by subtraction. This approach
does not take into account whether this is from a single deletion or from
multiple deletions which remove the wild-type amplicon region. The
second approach is deletion specific. The second amplicon is located across
the deletion breakpoint and so a product will only be amplified when a
specific deletion is present. Both approaches can be used with DNA binding
dyes or probe technologies. If selecting to use probe technology then
having a primer on either side of the deletion with the probe sequence
actually crossing the breakpoint will increase the reaction specificity to that
single deletion.
Mitochondrial DNA analysis 193
16228 15887
15583
15279
14976
577 289 0
1090 14673
1602 14410
2009 14148
2416 PH OH
12s F T
RNA Cyt b 13695
2823 D-Loop
V
16s P
3230 RNA PH
E 13242
ND6
L
3746
ND5 12789
ND1
I
4263 M
Q L
S
H 12336
4469
ND2 A
N ND4
W
C
Y
OL 12137
4991
R
ND4L
S
G ND3
5512 CO1 11451
CO3
D K ATPase6
CO2 ATPase8
5904
6280 10766
6668 10404
7056
7445 9990
9599
9207
8890
7857 8269 8572
Figure 11.2
Distribution of reported mtDNA deletions around the genome. Each single line
represents a single DNA deletion species, the regions covered by the line being
those removed by the deletion. Data taken from the MITOMAP web site. Only
deletions with reported breakpoints are illustrated. Numbers show the base
positions relative to the revised Cambridge Reference Sequence (rCRS). The bias
towards the major arc can clearly be seen.
Relative or absolute quantification?
Relative quantification is discussed by Pfaffl in Chapter 3. In its simplest
form, this is the comparison of the amplicon of interest to a control ampli-
con. For a mtDNA assay, either the mtDNA region (as above) or nDNA can
act as a control. When selecting a nDNA region it is useful to select a single
copy gene to allow for your experimental data to be easily adjusted to a
value per nuclear gene copy.
Relative quantification of an mtDNA reference gene/region to a sample
mtDNA gene/region allows for the calculation of the percentage of one
species to another. This in essence represents the percentage heteroplasmy of
194 Real-time PCR
a mtDNA sample. For the design of such experiments it is important that both
amplification reactions are linear over the expected experimental range of
DNA concentrations. Ideally, when analyzed over a DNA dilution series, both
reactions should generate equations for the line that are the same. From the
slope (gradient) of this line it is possible to show that the efficiency of ampli-
fication for both reactions is the same. The intercept value of the equation
shows whether for the same number of copies the reactions generate the same
Ct. Perhaps the more important of these two pieces of data is the slope, or PCR
amplification efficiency. Assuming that a PCR reaction is 100% efficient, each
molecule should be copied once each cycle, leading to a doubling of the copy
number each cycle. Over a log dilution series this equates to a 3.3 cycle differ-
ence between log dilutions. The slope of the line through the dilution series
should therefore be as close to –3.3 as possible. Slopes less than –3.4 indicate
a reaction that is less than 100% efficient. Conversely gradients greater than
–3.2 indicate an efficiency of more than 100%, most likely due to primer-
dimers formation or non-specific product formation. Consistency in the slope
indicates that the reaction is optimized, slope values between –3.2 and –3.4,
show a well optimized reaction. If the two reactions have the same slope this
shows that, over the linear range, the two reactions are consistent. If the inter-
cept is the same, then they are consistently the same. If the intercept is differ-
ent but the slope the same, and this is a reproducible difference, the two
reactions can still be compared and this difference can be accounted for
mathematically in the post-run data analysis.
Comparing the quantity of mtDNA to a nDNA reference allows correction
for the difference in the number of mononuclear cells present in each
sample. As we are not performing a gene expression study and simply a
DNA investigation, it does not matter if there is more than one copy of the
gene, or if it is differentially expressed in different cells. Any region or gene
can therefore be used. The same numbers of copies of each piece of nDNA
are present in every cell, so the fluorescent signal will be consistent between
samples containing the same number of cells. This is true in most circum-
stances, however not in cancer-derived cell lines, for example. Selection of
any region will allow the normalization of your mtDNA data. However, it is
more beneficial and we would recommend the selection of a single copy
gene as the nDNA reference target. This allows for the quantity of mtDNA
in the sample to be expressed as copies per diploid genome without the
need for an mtDNA copy number standard curve. A mtDNA : nDNA ratio in
this manner is of most use when investigating DNA extracted from bloods
or homogenate tissue samples, where the number of cells present is
unknown. If the study is on individual micro-dissected cells, then compari-
son to a nuclear target may not be necessary.
Unlike relative quantification methods, the absolute method requires a
known standard curve to generate meaningful data. This means, therefore,
that a series of standards needs to be generated. There are several means for
doing this and considerations that need to be taken into account for each.
Generating copy number standards
PCR generated DNA templates: by using a pair of nested primers it is quick and
easy to generate and quantitate a template to act as a standard for your
Mitochondrial DNA analysis 195
reactions. The first primer pair generates a large PCR product, containing the
region of mtDNA for investigation. This is then purified before being quanti-
fied. The second nested primer pair is used for the real-time reaction. We
have found from experience that there are some regions that simple will not
perform well as real-time templates. This is probably due to sequence charac-
teristics leading to unwanted secondary structure within the PCR product.
There are significant differences between the available methods for PCR
product purification and the subsequent performance of these products as
real-time PCR templates. PCR purification spin columns are one quick and
easy method for removing salt and unused PCR components from a product.
However, we have found that despite using no buffers, these columns have a
severely detrimental effect on real-time performance (Figure 11.3B). It may be
Figure 11.3
Different template preparations behave differently when used as absolute
quantification standard curves for two mtDNA assays. Reaction One detects
wild-type using a region of ND4 (black), the second detecting total mtDNA
using a region of ND1 (grey). Each graph shows the standard curve for both
reactions performed on 1:10 serial dilutions from different templates. A. whole
genomic DNA extract from blood; B. PCR amplified product, purified using PCR
purification spin columns; C. PCR amplified product, purified using gel
extraction; D. PCR product cloned into vector, circular; (E) PCR product cloned
into vector, linearized.
196 Real-time PCR
through an interaction with the spin column membrane, mechanical disrup-
tion or some chemical leeching from the membrane into the purified DNA
sample. We have routinely used spin columns to purify PCR products for
DNA sequencing with no problems, and continue to do so. However, we
have been unable to use this technology to purify templates for real-time
PCR reactions.
For the purification of PCR templates to be used as real-time standards we
would recommend the use of a gel extraction method. This process removes
all unincorporated PCR reaction components and leaves a single clean
template for use as a standard. However, when compared to genomic DNA
dilution series PCR template reactions do not always perform the same
(Figure 11.3C) and so caution is advised.
Cloned PCR templates: to ensure a continuing and reproducible supply of
your template it is convenient to use the nested primer pair approach, with
the addition of cloning the primary, large product into a vector before
transforming it into competent cells, extracting and purifying the DNA.
This has the added advantage of ensuring you have a homoplasmic supply
of your target region. For rare or low level heteroplasmic mutations this
may be of particular interest. Two lines of thought exist regarding the use of
cloned PCR products as real-time templates. The first suggests that for
maximum PCR efficiency the vector needs to be linearized by restriction
digest prior to real-time amplification. The second is that the vector be used
in its closed circular form. We have investigated both variations and
compared to the data obtained from genomic mtDNA. We have found that
for mitochondrial studies, reactions behave differently on cloned
templates, both closed (Figure 11.3D) and linear (Figure 11.3E), than on
genomic mtDNA.
Genomic mtDNA: there is something reassuring about being able to
compare like with like. Copy number standard curves based on PCR
products are not the same as 16.5 kb closed circular mtDNA genome
molecules (Figure 11.3A). However, there is the difficulty of quantifying
mtDNA in a DNA extract due to the presence of nDNA. We have investi-
gated several approaches to this. Ultra-centrifugation through a caesium
chloride gradient enables the separation of mtDNA from nDNA by the
differential movement through the gradient. We have found that through
using nDNA specific primers a product can be amplified from the ‘clean’
mtDNA fraction.
Southern blot analysis is another approach that could be used to quantify
mtDNA in a DNA extract. By running a known set of standards, quantified
pure PCR products, along with several dilutions of the homogenate DNA
sample and probing with an mtDNA specific probe the quantity of mtDNA
can be calculated. Quantification through this approach should be viewed
as inaccurate, in our opinion. There appears to be preferential binding of
the probe to the purified PCR products. This may be due to the PCR
products being short linear molecules that the probe can access more
readily.
The third approach requires a reliable real-time assay to already be in
place using one of the other two methods of generating a standard curve. A
genomic DNA sample can be quantified by real-time using either a PCR
template or cloned PCR product standard curve. Experience has shown that
Mitochondrial DNA analysis 197
for difficult amplicons the option of PCR template or cloned product as a
standard is not viable. However, other regions prove to be remarkably
reproducible by these methods. Awareness of the potential to introduce
errors in the calculation is inherent with this approach. Back calculation of
the quantification by independent methods is advised, either spectropho-
tometry or fluorimetry. Quantification of a genomic mtDNA sample by this
template real-time route has great benefits when investigating a difficult
region. A second benefit to this is the provision of a quantified standard for
any mitochondrial assays you design in the future. An example of absolute
quantification in determination of viral load is given in Chapter 14,
Protocol 3.
DNA extraction from single cells
As with every DNA based assay the quality of the DNA used in the assay has
a massive effect on the quality of the resulting data. When dealing with
DNA extracted from blood or tissue homogenates this does not pose a real
problem. There is a large selection of commercially available kits and proto-
cols which result in a high concentration of good quality DNA. DNA
obtained through this route performs very well in real-time reactions.
However, DNA quality can be a major problem when investigating
individual cells. Many commercially available kits do not cater for the low
quantity of DNA and small volumes involved when working with individ-
ual cells. When we applied a standard single cell lysis protocol for real-time
PCR amplification, considerable variability was observed in the absolute
copy number measurement. Partial lysis of the cell and poor DNA extrac-
tion are the most likely explanation. If the study requires the relative
quantification, then this does not pose such a huge problem, because ineffi-
cient extraction is unlikely to be template-specific. When measuring the
absolute amount of mtDNA in a sample, partial lysis poses a real problem. If
not all mtDNA molecules are available for amplification then it becomes
difficult to draw meaningful conclusions.
To examine the true effect of lysis conditions on the measurement of
absolute copy number, different lysis conditions should be considered. Cell
lysis buffers can contain EDTA, as this is a magnesium chelating agent its
effect on subsequent real-time reactions should be understood. Historically
individual cell lysis reactions have been kept at as small a volume as possi-
ble to maximize the final DNA concentration. DNA purification methods
are not 100% efficient. When measuring the quantity of mtDNA in a
sample, a percentage loss can mean any subsequent conclusions are flawed.
As such, post-lysis purification is not regularly performed. Table 11.4 shows
Table 11.4 Components and concentrations of different lysis buffers used to determine the
effect of lysis efficiency on the detectable mitochondrial copy number.
Lysis buffer Lysis buffer without EDTA ABI GeneAmp® PCR buffer plus
50 mM Tris-HCl, pH8.5 50 mM Tris-HCl, pH8.5 ABI GeneAmp® PCR buffer (1X)
1mM EDTA, pH8 0.5% Tween 20 0.5% Tween 20
0.5% Tween 20 100 μg Proteinase K 100 μg Proteinase K
100 μg Proteinase K
198 Real-time PCR
Table 11.5 mtDNA copy number measurements from skeletal muscle fibers
dissected from 20 μm cryostat sections and lyzed using different lysis
methods. TOT shows the total mtDNA copy number measured using a
region of ND1 and WT shows the wild-type mtDNA copy number
measured using a region of ND4. The % Deln value shows the percentage
deletion calculated using both measurements. Percentage deletion values
should be zero as the fibers are from a control individual without an
mtDNA deletion.
(A) Lysis buffer (B) Lysis buffer without EDTA
Copy number: Copy number:
TOT WT % Deln TOT WT % Deln
1530 32200 –2008.4 18000 19800 –9.9
538 27800 –5070.9 51200 13400 73.9
757 1950 –157.1 37800 11500 69.4
19400 2050 89.4 19000 50400 –164.7
6350 42800 –573.9 15800 12900 18.3
6210 12200 –1866.6 18600 10100 45.7
13900 1300 90.6 34600 13200 61.7
23200 5010 78.4 30000 12500 58.5
20000 957 95.2 46800 13300 71.5
8830 42100 –376.5 48600 14800 69.5
25500 8350 67.2 14500 45200 –212.1
1790 33800 –1784.6 12100 11100 8.2
(C) ABI GeneAmp® PCR buffer plus (D) Lysis buffer then purification
Copy number: Copy number:
TOT WT % Deln TOT WT % Deln
766 761 0.36 8190 8300 –1.4
1600 9430 –488.2 33800 6030 82.1
1120 2420 –116.0 59 2740 –4548.4
– – – 9890 7910 20.0
2670 2990 –12.1 7270 7640 –5.1
2550 3630 –42.3 29700 4230 85.7
9780 3200 67.3 10100 17300 –71.6
1320 15800 –1095.5 375 2740 –630.1
– – – 91100 16700 –83.3
3270 4210 –28.9 11000 40500 –268.9
2440 11500 –373.6 8460 7520 11.1
1290 1530 –18.3 55900 64600 –15.6
different lysis buffers and Table 11.5 show the effect the use of each buffer
has on the mtDNA copy number measured from skeletal muscle fibers taken
from 20 μm cryostat sections. What can be clearly observed is that the
inclusion of EDTA in the buffer increases the variability observed, whereas
a post-lysis purification markedly decreases the copy number measurement.
Lysis temperature and incubation times are yet another variable that can
have a large effect on the quantity and quality of DNA extract from a single
cell. Using the lysis buffer without EDTA (see Table 11.4), lysis conditions
over two temperatures and two incubation times have been investigated.
Mitochondrial DNA analysis 199
Table 11.6 Effect of lysis temperature and incubation time on mtDNA copy
number measured from control skeletal muscle fibers taken from 20 μm
cryostat sections.
2 hour incubation at: 16 hour incubation at:
37°C 55°C 37°C 55°C
15200 18500 17800 23000
7640 19500 20700 20400
22100 16300 12400 18000
15400 15400 17100 37200
20700 16800 27200 29800
15400 24400 15900 19500
21400 19800 51200 22400
15300 15400 19800 24300
15600 14900 23200 25100
15600 22200 22500 27900
17800 16900 14900 26000
16600 18500 21600 31300
Incubation at 37°C and 55°C and for both 2 hour and 16 hour-time periods
showed some variation in the copy number measured from single skeletal
muscle fibers taken from 20 μm cryostat sections. Incubating at 55°C for 16
hours appears to generate a higher and more reproducible copy number
value (Table 11.6).
Replicate analysis
When considering single-cell analysis and designing a real-time PCR assay,
it does not follow that the more concentrated the DNA sample the more
accurate the measurement. Many investigators may favor making a single
measurement on the complete lysis product, rather than replicate measure-
ments on multiple aliquots, either for data quality or cost reduction. It is
essential when analyzing mtDNA, or any DNA, by real-time PCR to make
replicate measurements on each sample/standard to have confidence in the
data obtained. In the majority of cases the replicates will be similar,
questioning the need and expense of replicate measurements. However,
there are times when an outlier occurs and the inclusion of this in the
analyzed data seriously affects the conclusions. When analyzing replicates
these outliers can be identified and removed from the analysis. However,
when making replicate measurements it is important to maintain the
pipetted volume at a sensible value. If trying to replicate small volumes, a
small percentage error in volume has a much greater effect on the final
measured quantity. To this end we would recommend that the minimum
final volume should be 5 ul, so the cell lysis volume should be adjusted to
allow for this. If using a SYBR® Green reaction this may limit the investiga-
tor to two targets per cell before the starting quantity of DNA is too dilute
to amplify. This raises the circumstances mentioned earlier when the
benefits of a multiplex probe based real-time assay would enable the
investigation of more targets per cell.
200 Real-time PCR
Table 11.7 Replicate vs. single measurements. A. Total (TOT) and wild-type
(WT) mtDNA copy numbers measured in five single skeletal muscle fibers
from a control individual. Four replicate measurements were made per fiber.
Highlighted in bold are potential outlier values, approximately a factor of
ten greater than the other three measurements; B. Average copy number
values for both TOT and WT including all four values from each fiber,
shown also is the calculated percentage deletion; C. Average copy number
values for both TOT and WT excluding the potential outliers, shown also is
the calculated percentage deletion. Exclusion of the potential outliers puts
the average TOT and WT copy numbers more in agreement with each
other, as expected in control fibers.
(A) (B)
Copy number Average values
TOT WT TOT WT % Deln
Fiber 1 30600 162000 Fiber 1 32400 64600 49.9
32500 32200 Fiber 2 65400 30500 −114.4
31800 31400 Fiber 3 18700 19800 5.69
34600 32600 Fiber 4 28800 29000 0.6
Fiber 5 63300 28100 −125.2
Fiber 2 172000 28600
28800 27800 (C)
29300 33700 Average values excluding outliers
31700 31900 TOT WT % Deln
Fiber 1 32400 32000 –1.0
Fiber 3 14600 21100 Fiber 2 29900 30500 1.8
18400 19700 Fiber 3 18700 19800 5.7
20300 19300 Fiber 4 28800 29000 0.7
21300 19000 Fiber 5 26300 28300 7.3
Fiber 4 29200 30300
29200 28100
27700 28600
28900 28800
Fiber 5 24800 25000
27300 28600
26700 31500
174000 27400
In skeletal muscle fibers from control individuals we have investigated
replicate versus single measurements. We performed two reactions per fiber
using a single measurement for each reaction (i.e. measuring the percentage
deletion). In control fibers, the copy number value obtained from each
reaction should be identical and the calculated percentage deletion should
be zero. The calculation of the ratio magnifies the observed error however,
high percentage deletion values and large negative values can be seen (see %
Deln values in Table 11.5). When the investigation was repeated making
quadruplicate measurements for two reactions there was often a single
replicate which stands out as an obvious outlier (Table 11.7). With all repli-
cate values included in that analysis, the percentage deletion values can be
seen to be more variable. Statistically, the outlier values can be legitimately
Mitochondrial DNA analysis 201
removed if they fall outside of two standard deviations of the remaining
three replicates. When this screening is applied we can see that the percent-
age deletion values lie much closer to the zero value expected.
Real-time PCR reaction optimization
Optimization of a real-time assay is covered in more detail in Chapters 1
and 3, however it cannot be over-stressed how important the careful
optimization of all reaction components and conditions is. Primer and
probe concentrations should be optimized to give the earliest signal for a
specific amplicon, this ultimately equates to the sensitivity of the reaction.
The annealing temperature for any given primer set, or primer/probe
combination can be calculated by any number of different means. These
calculated temperatures are not always the temperatures at which the best
performance is achieved. Standard PCR on a gradient block PCR machine
can be used to check the specificity of real-time primers. To check the speci-
ficity of a primer/probe combination then a gradient on a real-time PCR
machine will allow visualization of the fluorescence signal from the probe.
The melting curve from a SYBR® Green real-time reaction gives a reasonable
indication as to the number of products amplified in a reaction. However,
as the amplicon ‘melts’ at a range of temperatures along its length until
completely single stranded, these peaks are quite broad. Products very
similar in size may not be distinguishable by this approach.
Magnesium chloride concentration affects the activity of the polymerase
in the reaction. Polymerases from different manufacturers will all require
different magnesium chloride concentrations to enable them to perform
maximally. The best indicator for optimization is the PCR efficiency and
reaction reproducibility. The PCR efficiency is taken from the number of
PCR cycles between log dilutions of a standard template and was discussed
earlier. Most manufacturers supply reagents with an optimized buffer. This
should perform well for the majority of amplicons. However, magnesium
chloride concentration should be optimized for each reaction by amplifying
a dilution series at a range of magnesium chloride concentrations.
Comparison of the PCR efficiencies will enable the investigator to select the
optimum concentration for each assay they design. Figure 11.4 shows a
magnesium chloride optimization experiment for an mtDNA real-time
assay in the ND1 region. Magnesium chloride concentrations of 1.5 mM,
2.5 mM, 3.0 mM, 3.5 mM, 4.0 mM and 4.5 mM are shown in Figure 11.4
parts A to F respectively. As mentioned previously investigators should aim
to have reactions with a slope as close to –3.3 as possible. An important
issue is the consistency of efficiency. An efficiency of 96% on one run and
then 65% on a subsequent run highlights an assay that is not well
optimized.
11.4 Discussion
What we hope to have presented here is a coherent flow through the
considerations when designing an mtDNA real-time PCR assay. Many of
these considerations are no different to when designing any real-time assay,
nuclear or mitochondrial, and where this is the case we have directed the
202 Real-time PCR
investigator to the relevant chapter. As a large amount of mitochondrial
research is carried out at the level of the individual cell, we feel that it is
these considerations that should strongly influence the design and
Figure 11.4
Effect of final Magnesium Chloride concentration of real-time PCR efficiency.
Each graph shows a 1:10 serial dilution series, amplified for a region of ND1.
Inset on each graph is the standard curve at that magnesium chloride
concentration showing the equation for the line, the R2 value and the PCR
efficiency. A. 1.5 mM; B. 2.5 mM; C. 3.0 mM; D. 3.5 mM; E. 4.0 mM;
F. 4.5 mM. Improved reaction efficiency can be seen as the magnesium chloride
concentration increases.
Mitochondrial DNA analysis 203
optimization of a real-time assay and have focused the attention of this
chapter in that direction.
The variability in the real-time PCR machines and in the different
manufacturers’ reagents, together with the numerous different targets make
it impossible to generate a generic protocol for an mtDNA real-time assay.
We have covered what we believe to be the main considerations when
working in the mtDNA field and feel it is sufficient to say that any real-time
assay has the potential to generate strong data if correctly optimized. We
would advise strongly against trying to cut corners and costs by minimizing
the optimization and replicate analysis. Optimization and validation is
essential to be able to draw conclusions from real-time data and should be
carried out in accordance with guidelines laid out in the other chapters of
this book. The conditions found to work for one assay will not necessarily
work well for all.
References
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC,
Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG (1981)
Sequence and organization of the human mitochondrial genome. Nature
290(5806): 457–465.
Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N
(1999) Reanalysis and revision of the Cambridge Reference Sequence for human
mitochondrial DNA. Nature Genetics 23(2): 147.
Attardi G (2002) Role of mitochondrial DNA in human aging. Mitochondrion 2: 27–37.
Coller HA, Khrapko K, Bodyak ND, Nekhaeva E, Herrero-Jimenez P, Thilly WG
(2001) High frequency of homoplasmic mitochondrial DNA mutations in
human tumors can be explained without selection. Nat Genet 28(2): 147–150.
de Mendoza C, Sanchez-Conde M, Ribera E, Domingo P, Soriano V (2004) Could
mitochondrial DNA quantitation be a surrogate marker for drug mitochondrial
toxicity? AIDS Rev 6(3): 169–180.
Fayet G, Jansson M, Sternberg D, Moslemi AR, Blondy P, Lombes A, Fardeau M,
Oldfors A (2002) Ageing muscle: clonal expansions of mitochondrial DNA point
mutations and deletions cause focal impairment of mitochondrial function.
Neuromuscul Disord 12(5): 484–493.
Hoy JF, Gahan ME, Carr A, Smith D, Lewin SR, Wesselingh S, Cooper DA (2004)
Changes in mitochondrial DNA in peripheral blood mononuclear cells from
HIV-infected patients with lipoatrophy randomized to receive abacavir. J Infect
Dis 190(4): 688–692.
Lewis W, Day BJ, Copeland WC (2003) Mitochondrial toxicity of NRTI antiviral
drugs: an integrated cellular perspective. Nat Rev Drug Discov 2(10): 812–822.
McComsey G, Bai RK, Maa JF, Seekins D, Wong LJ (2005a) Extensive investigations
of mitochondrial DNA genome in treated HIV-infected subjects: beyond
mitochondrial DNA depletion. J Acquir Immune Defic Syndr 39(2): 181–188.
McComsey GA, Paulsen DM, Lonergan JT, Hessenthaler SM, Hoppel CL, Williams
VC, Fisher RL, Cherry CL, White-Owen C, Thompson KA, Ross ST, Hernandez
JE, Ross LL (2005b) Improvements in lipoatrophy, mitochondrial DNA levels
and fat apoptosis after replacing stavudine with abacavir or zidovudine. Aids
19(1): 15–23.
Michikawa Y, Laderman K, Richter K, Attardi G (1999a) Role of nuclear background
and in vivo environment in variable segregation behavior of the aging-
dependent T414G mutation at critical control site for human fibroblast mtDNA
replication. Somat Cell Mol Genet 25(5–6): 333–342.
204 Real-time PCR
Michikawa Y, Mazzucchelli F, Bresolin N, Scarlato G, Attardi G (1999b) Aging-
dependent large accumulation of point mutations in the human mtDNA
control region for replication. Science 286(5440): 774–779.
MITOMAP (2005) A Human Mitochondrial Genome Database. http://www.
mitomap.org
Penta JS, Johnson FM, Wachsman JT, Copeland WC (2001) Mitochondrial DNA in
human malignancy. Mutat Res 488(2): 119–133.
Spinazzola A, Zeviani M (2005) Disorders of nuclear-mitochondrial intergenomic
signaling. Gene 18: 162–168.
Szuhai K, Ouweland J, Dirks R, Lemaitre M, Truffert J, Janssen G, Tanke H, Holme E,
Maassen J, Raap A (2001) Simultaneous A8344G heteroplasmy and mitochon-
drial DNA copy number quantification in myoclonus epilepsy and ragged-red
fibers (MERRF) syndrome by a multiplex molecular beacon based real-time
fluorescence PCR. Nucleic Acids Res 29(3): E13.
Woischnik M, Moraes CT (2002) Pattern of organization of human mitochondrial
pseudogenes in the nuclear genome. Genome Res 12(6): 885–893.
Zuker M (2003) Mfold web server for nucleic acid folding and hybridization predic-
tion. Nucleic Acids Res 31(13): 3406–3415.
Real-time immuno-PCR
Kristina Lind and Mikael Kubista 12
12.1 Introduction
12.1.1 Immunoassays
Immunoassays make use of the excellent binding specificity of antibodies
and have been used for protein detection since the 1960s (Yalow and
Berson, 1960). Antibodies can be directed with high specificity to a large
variety of antigens. The still most popular and used technique for protein
quantification, ELISA, was developed in the 1960s (Engvall and Perlman,
1971). Sandwich ELISA uses one antibody to capture the analyte and an
enzyme immobilized by a second antibody for detection. The enzyme
catalyzes a colorimetric reaction which product is readily detected for
quantification. Through the reaction the signal from the analyte increases
linearly in time and low concentrations of the antigen can be detected.
12.1.2 Immuno-PCR
In 1992 Sano et al. developed immuno-PCR, which is an immunoassay
similar to ELISA but uses PCR for the detection instead of a colorimetric
enzyme reaction. They constructed a streptavidin-protein A chimera that
was bound to a biotinylated linear plasmid. The protein A-streptavidin-
DNA-conjugate bound the detection antibody which was connected to the
analyte in the microtiter plate. The DNA was then amplified by PCR. The
PCR product was finally detected by gel electrophoresis (Sano et al., 1992).
In an alternative setup the amplified PCR product was detected by PCR
ELISA (Niemeyer et al., 1997). Here biotin labeled PCR primers and a
digoxigenin labeled nucleotide was used. Following PCR the products were
immobilized in streptavidin coated microtiter plates and analyzed by ELISA
using digoxigenin IgG-alkaline phosphatase conjugate. These post-PCR
analysis methods are time consuming and cross-contamination is a major
problem. Further drawback is that the PCR is run to completion resulting in
loss of linearity. A much easier, faster and more convenient approach is to
use real-time PCR for direct quantification of the DNA (Figure 12.1). This
was first demonstrated by Sims et al., 2000. Compared to ELISA, real-time
immuno-PCR is more sensitive and has much larger dynamic range (Figure
12.2). These advantages are due to the fundamentally different signal
generation and detection processes. In ELISA the detection antibody is
coupled to an enzymatic system that generates linear signal increase with
time, while in real-time immuno-PCR the detection antibody is coupled to
a nucleic acid template that generates an exponential signal growth in time
206 Real-time PCR
Real-time immuno-PCR ELISA
Figure 12.1
Schematic set-up of real-time immuno-PCR and ELISA.
2.2
14 2.0
1.8
16
Real-time immuno-PCR, Ct
1.6
ELISA, absorbance
1.4
18
1.2
20 1.0
0.8
22
0.6
24 0.4
0.2
26 0.0
5 6 7 8 9 10 11
Log (molecules of PSA)
Figure 12.2
Comparison of real-time immuno-PCR (squares) and ELISA (triangles) on
standard samples. Reprinted from Journal of Immunological Methods, 304,
107–116, Figure 5 with permission from Elsevier B.V.
when amplified by PCR. Further, ELISA signal is read out as intensity value
at the end of the reaction, while in real-time PCR the number of amplifica-
tion cycles to reach a particular signal level is registered.
12.2 Assemblages for real-time immuno-PCR
The immunoassay can be assembled in several ways that differ mainly in
two aspects: how the capture antibody is bound to the surface, and how the
DNA-label is attached to the detection antibody (Lind and Kubista, 2005).
Real-time immuno-PCR 207
12.2.1 Attaching capture antibody
A straightforward way to attach the capture antibody to the vessel surface is
by physical adsorption. No special tubes or linking groups are needed. A
solution containing the antibody is added to the wells and incubated
overnight allowing the antibodies to adsorb to the surface. Some will have
their antigen binding site facing upwards being accessible and some will
have the antigen binding site hidden. The capture antibody can also be
attached through a streptavidin-biotin link. This requires that the capture
antibody is biotinylated and that the surface is coated with streptavidin.
With this setup the capture antibody can either be attached to the surface
before being exposed to the antigen or it can be incubated in the test
solution to bind antigen and then immobilized to surface. The assay time
with this approach is much shorter than with physical adsorption.
Drawback is that streptavidin coated plates are many times more expensive
than regular plates.
12.2.2 Labeling detection antibody with DNA
There are currently two established ways to attach a DNA-label to the detec-
tion antibody. One is through streptavidin-biotin linkage and the other by
covalent coupling using a heterobifunctional cross-linking agent. The strep-
tavidin-biotin link is usually assembled stepwise by incubating one compo-
nent at a time during the assay. This is rather straight forward but requires
additional incubation and washing steps, which increase technical varia-
tion. The covalent antibody/DNA conjugate is prepared in advance and
purified. This reduces the number of reaction components, making the
assay easier to optimize.
12.3 Real-time immuno-PCR details
12.3.1 Reaction containers and instruments
Immunoassays, like ELISA, are performed in plates optimized for protein
binding. These are typically made of polystyrene or polycarbonate. For
real-time immuno-PCR containers that fit, real-time PCR instruments are
needed. Regular ELISA plates do not fit PCR instruments because they have
flat bottoms and their size does not match regular PCR blocks.
Immunoassays are most conveniently performed in 96-well plates or in
strips of eight or twelve tubes. A multichannel pipettor can then be used to
add assay components and for washing. Nunc® TopYield polycarbonate
strips are flat bottomed and fit normal PCR blocks. These have been used
in real-time immuno-PCR attaching the capture antibody by physical
adsorption to the wells (Adler et al., 2003). Regular polypropylene plates
for real-time PCR, such as the AB-0600 from ABgene, that fit, for example,
the iCycler iQ®, from Biorad, can also be used. When we compared the
polypropylene plates with the polycarbonate strips we obtained higher
reproducibility with the polypropylene container. The polypropylene
plates are also available coated with streptavidin for attachment of capture
antibody via biotin.
208 Real-time PCR
A number of real-time PCR instruments on the market are suitable for
real-time immuno-PCR. We find the 96-well platforms most convenient.
Our lab has tested the iCycler iQ® from Biorad, the 5700 and 7700 from ABI,
the Mx3005p from Stratagene, and the Quantica from Techne, with very
good results when using the 96-well microtiter plates recommended by the
respective vendors. Also the capillary based LightCycler® has been used for
real-time immuno-PCR (McKie et al., 2002). Here the assay was first built up
in an ELISA compatible 96-well plate. The DNA-label was then cut by a
restriction enzyme and the solution was transferred to LightCycler® capil-
laries for real-time PCR analysis.
12.3.2 DNA-label
The DNA-label serves as template for the PCR and should be carefully
designed. Most important is that the DNA-label and the primer pair used
produce negligible amounts of non-specific primer-dimer products. Its
length does not seem to be crucial. We have tested lengths between
66–1098 bp and found no important dependence. However, we have not
performed any systematic study. Usually we design the PCR system to give
short amplicons (60–150 basepairs), to have high PCR efficiency and to
keep cost down. If streptavidin-biotin linkage is going to be used to connect
the DNA to the detection antibody, biotinylated primers can be used to
produce the DNA-label. For chemical conjugation suitably modified
polynucleotides are available from most oligohouses, and the shorter they
are, the less expensive. The modification can be either an amino- or a thiol-
group depending on the chemistry that will be used. If succinimidyl-4-(N-
maleimidomethyl) cyclohexane-1-carboxylate (SMCC) is used, the
polynucleotide should be amino modified. We always modify the 5’ end of
the polynucleotide because it is cheaper, but 3’ end modifications should
also be fine. To minimize risk of contamination, we recommend using a
different DNA sequence for real-time immuno-PCR from those used by
others in the lab. Ideally a non-natural DNA sequence can be designed.
Such DNA sequences including primers and protocol are available from our
center (www.tataa.com).
12.3.3 Blocking agents
In immunoassays, non-specifically bound reagents give rise to background
signal that limits assay sensitivity. To reduce the background, blocking
agents are used. These are often inert protein blends, such as bovine serum
albumin (BSA) and milk powder. Other common additives are detergents,
such as Tween 20. The blocking agents cover any empty surface preventing
direct binding of the reaction components to the vessel.
12.3.4 Controls
The performance of the real-time immuno-PCR assay can be tested by
running a number of control reactions in parallel with the test samples. The
background signal from non-specifically bound assay components is
assessed by a background control (BC) that contains the same amount of
Real-time immuno-PCR 209
antibodies and DNA as positive samples, but without antigen. The BC signal
is caused by non-specific adsorption of reaction components and should
have as high Ct as possible. The second control is the no template control
(NTC). The NTC contains the real-time PCR mastermix only. It reveals any
contamination of the mastermix and its Ct reflects primer-dimer formation.
If the NTC and BC have similar Ct, primer-dimer formation limits sensitiv-
ity, and it is probably a good idea to redesign the real-time PCR assay.
12.3.5 Optimizing concentrations
When setting up an assay for the first time, it is important to optimize the
capture and detection antibodies’ of concentrations. In the following, we
describe a basic procedure of how to optimize a standard set-up based on
adsorbed capture antibody and chemically conjugated detection
antibody/DNA. The optimal concentrations depend on the type of antibod-
ies used, but are typically in the range 1–20 μg ml–1 for the capture antibody
and 1–100 ng ml–1 of detection antibody. Using antibodies with higher
affinity and specificity for the antigen usually results in more sensitive
assay. To determine optimal concentrations of capture and detection
antibodies, an evaluation set-up with serial dilutions of both antibodies and
antigen, as shown in Figure 12.3, can be performed. In a first attempt the
real-time immuno-PCR protocol below can be used.
A1 A2 A3 A1 A2 A3
1 1 1 1 1 1
2 2 2 2 2 2
B1 B3
3 3 3 3 3 3
BC BC BC BC BC BC
1 1 1 1 1 1
2 2 2 2 2 2
B2 B4
3 3 3 3 3 3
BC BC BC BC BC BC
Figure 12.3
Microtiter plate set-up for capture and detection antibody concentration
optimization. 1–3 represent different concentrations of antigen covering the
range of interest. BC is the background control. A1–A3 is a ten-fold dilution
series of capture antibody, and B1–B4 is a five-fold dilution series of detection
antibody/DNA conjugate.
210 Real-time PCR
The combination of capture and detection antibodies’ concentrations
that give largest Ct difference between the lowest antigen concentration
and the BC sample is the best choice, of course, provided they are within
the linear range of Ct versus the logarithm of antigen concentration. If this
is not the case one must choose different concentrations of the antibodies
or replace them.
References
ACS Committee on Environmental Improvement (1980) Guidelines for data acquisi-
tion and data quality evaluation in environmental chemistry. Anal Chem 52:
2242–2249.
Adler M, Wacker R, Niemeyer CM (2003) A real-time immuno-PCR assay for routine
ultrasensitive quantification of proteins. Biochem Biophys Res Commun 308:
240–250.
Engvall E, Perlman P (1971) Enzyme-linked immunosorbent assay (ELISA).
Quantitative assay of immunoglobulin G. Immunochemistry 8: 871–874.
Lind K, Kubista M (2005) Development and evaluation of three real-time immuno-
PCR assemblages for quantification of PSA. J Immunol Methods 304: 107–116.
McKie A, Samuel D, Cohen B, Saunders NA (2002) Development of a quantitative
immuno-PCR assay and its use to detect mumps-specific IgG in serum. Journal of
Immunological Methods 261: 167–175.
Niemeyer CM, Adler M, Blohm D (1997) Fluorometric polymerase chain reaction
(PCR) enzyme-linked immunosorbent assay for quantification of immuno-PCR
products in microplates. Analytical Biochemistry 246: 140–145.
Sano T, Smith CL, Cantor CR (1992) Immuno-PCR: Very sensitive antigen detection
by means of specific antibody-DNA conjugates. Science Washington DC 258:
120–122.
Sims PW, Vasser M, Wong WL, Williams PM, Meng YG (2000) Immunopolymerase
chain reaction using real-time polymerase chain reaction for detection. Anal
Biochem 281: 230–232.
Yalow RS, Berson SA (1960) Immunoassay of endogenous plasma insulin in man. J
Clin Invest 39: 1157–1175.
Real-time immuno-PCR 211
Protocol 12.1: Basic
real-time immuno-PCR
protocol
Chemicals: Adsorption buffer: 0.2 M NaH2PO4
Wash buffer: 0.154 M NaCl, 5 mM Tris pH 7.75,
0.005% Tween 20, and 0.1% Germall
Blocking/incubation buffer: 0.5% BSA, 0.05%
Tween 20 in phosphate buffered saline pH 7.3
(137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4,
and 1.4 mM KH2PO4)
Capture antibody
Detection antibody/DNA conjugate
Antigen standard
PCR chemicals
Equipment: For washing: use either a multichannel pipette or
Nunc® immunowash. Other automatic washing
devices that handle V-shaped PCR-tubes can also
be used.
Real-time PCR instrument with 96-well plate
format.
Precision pipettes
PCR microtiter plate
Adhesive seal
Vortex
Microcentrifuge
1. Adsorption of capture antibody. Dilute
capture antibody to desired concentration in
0.2 M NaH2PO4. A volume of 2,500 μl is
needed per 96-well plate. Add 25 μl of the
capture antibody solution to each well and
cover the plate with adhesive seal. Incubate at
4 ºC overnight (see Figure 12.4)
2. Blocking. Wash the antibody coated wells
three times with wash buffer. Add 200 μl
blocking buffer to each well. Cover with
adhesive seal and incubate at 37ºC for 1 h or
at 4ºC overnight
3. Prepare analyte and detection
antibody/DNA conjugate solution. Prepare
an analyte dilution series by diluting stock
212 Real-time PCR
Figure 12.4
Steps in basic real-time immuno-PCR.
antigen solution in incubation buffer. The
standard concentrations should cover the
concentrations of the samples that will be
analyzed. Never attempt to quantify antigen
at concentrations outside the range of the
standards. Prepare also an antibody/DNA
conjugate solution of suitable concentration
in incubation buffer. For duplicate samples
mix 11 μl of either the analyte standard or the
test sample with 44 μl of diluted conjugate
solution in a clean microtiter plate. Prepare
BC samples by mixing 11 μl of incubation
buffer with 44 μl of the conjugate solution in
a separate tube. Incubate all samples for 1 h
at room temperature
Real-time immuno-PCR 213
4. Add samples to the wells. Wash the blocked
wells ones with wash buffer and add 25 μl of
the incubated samples to each well. Seal with
adhesive seal and incubate at room tempera-
ture for 1 h
5. Wash the wells six times with wash buffer and
ten times with milli-Q water
6. Tap the microtiter plate upside down on
paper towels to remove as much of the water
as possible
7. Run real-time PCR. Add 25 μl PCR mastermix
to each well. Prepare also an NTC by adding
PCR mastermix to a clean well. Seal the
microtiter plate with an adhesive seal that is
compatible with the real-time PCR instru-
ment. Start the PCR. Use the same cycling
protocol as for the regular real-time PCR
Data analysis Construct a standard curve from the standard
samples by plotting Ct versus the logarithm of
analyte concentration. Fit a line by linear regres-
sion to the data points that follow linear response.
Frequently the lowest and highest concentrations
deviate from linearity. To include those one may
use more advanced models, such as 3rd degree
polynomial to fit the data points. To determine
the sensitivity of the assay, run replicates of the
BC together with the standard curve samples
(Plate scheme in Figure 12.5). Estimate the appar-
ent concentrations the BC signals correspond to
using the standard curve, and calculate the
standard deviation (SD) and mean. The limit of
detection is defined as the mean of the apparent
concentrations of the BC samples plus three times
the SD (ACS Committee on Environmental
Improvement, 1980). The reproducibility of the
assay is determined from at least eight replicates
of standard samples with high, medium, and low
analyte concentration that are run together with a
complete standard curve (Figure 12.5). The
sample concentrations should be within the linear
range of the standard curve. Estimate the concen-
trations from the repeat samples from the
standard curve and calculate their mean and the
SD. Finally calculate the relative standard devia-
tion at the three concentrations as the SD/mean.
Typically the relative standard deviation decreases
with increasing analyte concentration.
214 Real-time PCR
BC BC BC L M H
1 1 BC L M H
2 2 BC L M H
3 3 BC L M H
4 4 BC L M H
5 5 BC L M H
6 6 BC L M H
7 7 BC L M H
Figure 12.5
Microtiter plate set-up to estimate the sensitivity and reproducibility of the real-
time immuno-PCR. Numbers 1 to 7 represent standard antigen samples of
different concentrations. BC is the background control. Repeats of standard
samples with low (L), medium (M), and high (H) concentrations of antigen.
Preparing and purifying antibody/DNA conjugates
There are many heterobifunctional cross-linking agents suitable for conjuga-
tion of a DNA-label to a detection antibody. They have two reactive groups,
one that reacts with the antibody, and a second that reacts with the DNA-label
joining them together. We usually use SMCC (Figure 12.6), which reacts with
an amino-group and a thiol-group. Thiol-groups can be added to antibodies
by treating them with 2-iminothiolane (Traut’s reagent), which reacts with
primary amines introducing the sulfhydryl groups. The polynucleotide can be
synthesized with an artificial amino-group in either end for coupling to SMCC.
Conjugation is performed by first reacting the polynucleotide with SMCC and
then reacting the SMCC-polynucleotide conjugate with the sulfhydryl
activated antibody (Figure 12.6).
Conjugation protocol
Chemicals: Detection antibody
5’ aminomodified polynucleotide
TSE pH 8.5 (0.1 M triethanolamine, 0.1 mM
sodium chloride, 1 mM EDTA, pH 8.5)
2-iminothiolane
Glycine pH 7.3
TSE pH 12.9 (0.1 M triethanolamine, 0.1 mM
sodium chloride, 1 mM EDTA, pH 12.9)
SMCC
DMSO
TSE pH 7.3 (0.1 M triethanolamine, 0.1 mM
sodium chloride, 1 mM EDTA, pH 7.3)
Real-time immuno-PCR 215
Figure 12.6
Conjugation of DNA and antibody with SMCC.
Equipment: Precision pipettes
NAP-5, NAP-10, or PD-10 columns (Amersham
Biosciences)
Centricon YM-30 (Millipore)
Vortex
Centrifuge
Glass vial
1. Change buffer of the detection antibody
solution to TSE (pH 8.5) and concentrate to
3–5 mg antibody per ml using, for example,
Centricon YM-30 (Millipore)
2. Prepare 50 mM solution of 2-iminothiolane in
TSE (pH 12.9) and mix immediately with the
antibody solution in proportion 1:33. For
example, if the antibody volume is 1 ml, add
30 μl 2-iminothiolane. Incubate for 30 min at
room temperature
3. Quench the reaction with 1 M glycine (pH
7.3) using the same volume as of 2-imino-
thiolane
4. Purify the activated antibody with a small gel
filtration column such as NAP-5, NAP-10, or
PD-10 using TSE (pH 7.3). The activated
antibody is not very stable and should be
used within 2 h
5. Dilute the polynucleotide to about 70 nmol
ml-1 in 0.1 M TS (pH 7.7). The molar amount
of the polynucleotide should be approximately
two times the molar amount of antibody used
216 Real-time PCR
6. Dissolve 3–5 mg of SMCC in DMSO to 20
mM in a small glass vial
7. Add SMCC to the polynucleotide solution to
a concentration of 2 mM. Incubate for 20
min at room temperature
8. Quench the reaction by adding 1/50 volume
of 1 M glycin (pH 7.3) to the tube
9. Purify the activated polynucleotide with a
small gel filtration column, such as NAP-5,
NAP-10, or PD-10. Elute with TSE (pH 7.3).
The activated polynucleotide should be used
within 2 h
10. Determine the concentrations of antibody
and polynucleotide spectroscopically
11. Mix the polynucleotide and antibody in a 2:1
molar ratio
12. Incubate 1 h at room temperature, and store
the reaction tube in the refrigerator for at
least 2 h and at most 72 h before purification
Purification protocol
Rigorous purification of the antibody/DNA conjugate is crucial for the sensitiv-
ity of the assay. Different methods to remove non-conjugated antibody and
free DNA can be used. We recommend first removing free antibody with
anion-exchange chromatography followed by gel filtration to separate the free
DNA from the conjugate.
Ion-exchange column: Resource® Q 1 ml
(Amersham Biosciences)
Buffers: 10 mM Tris pH 8.0 in 0 M NaCl and in
1.5 M NaCl for gradient elution.
Collect eluate with fraction collector.
Identify the fractions containing free DNA and
antibody/DNA conjugate by absorption
spectroscopy. Pool and concentrate these
fractions using a Centricon YM-100 (Millipore), or
similar, to a volume (typically about 0.5 ml)
suitable for the gel filtration column to be used.
Gel filtration column: Superdex 200 HR10/30
(Amersham Biosciences)
Buffer: 50 mM Tris, 1 mM EDTA, 0.15 M NaCl,
pH 8.0.
Collect eluate with fraction collector
Fractions to use in real-time immuno-PCR are best
identified in test runs. The amount to use in the
test runs can be estimated by regular real-time
PCR. Fractions containing active conjugate are
Real-time immuno-PCR 217
pooled and stored either in refrigerator or freezer.
About 5 mg ml–1 of BSA can be added to stabilize
the solution. Although it may depend on the
antibodies, we have found stock conjugate
solutions to be stable upon storage at +4ºC or
–20ºC for at least 1 year.
Clinical microbiology
Burcu Cakilci and Mehmet Gunduz 13
13.1 Introduction
13.1.1 Importance of detection and quantification in microbiology
The contribution of clinical microbiology laboratories to the effective
treatment of patients with bacterial infections depends on early and
accurate identification, and rapid susceptibility testing of bacteria. The
rapid, specific, and sensitive detection of the pathogens is essential for
providing immediate therapeutic intervention, subsequent control of
potential epidemics, and has a great impact on the outcome of individual
patients especially those with systemic infections or immune disorders.
Although detection and identification of pathogenic microorganisms is the
essence of culture-based assays in clinical microbiology; importance of
quantitative measurements of pathogens has increased and extended to
monitoring effectiveness of the antibiotics. Recently, quantification of
pathogenic microorganisms and their activities has become almost as
important as their rapid detection and identification.
13.1.2 From traditional methods to real-time PCR in microbiology
Prior to development of the recent molecular diagnostic technologies and
their applications in microbiology laboratories, traditional diagnostic
methods were used for qualification and quantification of the microorgan-
isms. Direct counting of individual cells by microscopy from samples or
culture plates was probably the oldest technique used for microbial
quantification. DNA binding stains were also used for the same purpose
(Jansson and Prosser, 1997). As enumeration has been of interest, many
different cell detection techniques have been developed including
fluorescent tagged antibodies, rRNA targeted fluorescent oligonucleotides,
confocal laser scanning microscopy and flow cytometric methods (Jansson
and Prosser, 1997). Among the traditional methods culture and culture-
based methods were considered as reliable approaches and mostly named as
the ‘gold standard’ for the identification and quantification of bacteria.
Besides being time-consuming, traditional methods have some limitations
such as poor sensitivity, slow growing or poorly viable organisms, narrow
detection ranges, complex interpretation, high levels of background, and
non-specific cross-reactions (Mackay, 2004). Traditional microbial culture
methods supply valuable data especially for new, uncharacterized or
atypical organisms for further studies and epidemiological assessments
(Mackay, 2004).
220 Real-time PCR
There has been a sharp increase in molecular biological techniques over
the last few decades, which has resulted in developments in many areas of
the life sciences, including bacteriology (Millar and Moore, 2004). The field
of molecular biology has been revolutionized by amplifying as few as one
copy of a gene into billions of copies, after the introduction of PCR. PCR-
based methods offer high sensitivity, specificity and simplification of testing
by process automation and incorporation of non-isotopic detection
(Sintchenko et al., 1999). In the early stages, the use of PCR methodology was
limited by the qualitative nature of PCR-based applications. The logarithmic
amplification of the target sequence in PCR reveals with no correlation
between the initial and final amounts of DNA product. Due to this limita-
tion, conventional PCR is considered a semiquantitative technique.
Recently, real-time PCR technology appeared as a major development
among the PCR-based systems. In these assays, fluorescent signals are
generated as the PCR takes place and thus real-time monitoring during
the amplification is possible. This useful combination of nucleic acid
amplification and signal detection has reduced the time required for
nucleic acid detection. In addition, as a quantitative method for detection
of bacterial species, sensitivity of real-time PCR enables detection of less
than 10 cells with sensitive background regulations (Maeda et al., 2003;
Ott et al., 2004). Today, real-time PCR is used to detect nucleic acids from
food, vectors used in gene therapy protocols, genetically modified organ-
isms, and areas of human and veterinary microbiology and oncology
(Mackay, 2004).
13.2 Real-time PCR studies in microbiology
13.2.1 Basics for microbial quantitation
In real-time PCR, it is possible to measure the amount of PCR product at any
time point. During the exponential phase in real-time PCR experiments, a
cycle threshold (Ct) is determined at which point the fluorescence signal
generated from a sample is significantly greater than background fluores-
cence. These Ct values are directly proportionate to the amount of starting
template and are the basis for calculating mRNA expression levels or DNA
copy number measurements. The quantification of the PCR product at
specific cycle numbers allows complete understanding of the PCR process
with truly quantitative estimations.
External and internal controls
All real-time PCR assays should include positive and negative controls and
reliability of an assay is intimately associated with the quality of the assay
controls. Some substances found in clinical samples can inhibit PCR, poss-
ibly via effecting binding and/or polymerization activity of DNA poly-
merases, such as bile salts and complex polysaccharides of feces and heme
of blood (Nolte, 2004; Monteiro et al., 1997; Al-Soud and Radstrome, 2001).
Degradation of target nucleic acid, sample processing errors, thermal cycler
malfunction, and carry-over contamination are some of the other reasons
that may cause false-negative results (Nolte, 2004).
Clinical microbiology 221
External controls are simple approaches to detect inhibitors but addition
of an external control to a separate reaction increases the costs and does not
always work for large batch sizes (Nolte, 2004). Usually, an external control
is created by using a cloned amplicon, a portion of the target organisms’
genome, or simply the purified amplicon itself (Mackay, 2004). The data
generated from individual amplification of the known dilution series of
external control create the basis of the standard curve which is used for
analyzing the unknown sample content. Internal controls, which are spiked
into clinical patient sample, provide an accurate way to check the integrity
of all amplification steps. They should imitate the target sequence and if
they are not amplified, that should indicate the inhibition of the PCR
analysis of clinical patient sample (Nolte, 2004; Cockerill, 2003). Melting
curve analyses can be another important quality control feature that
confirms PCR amplicons as the correct amplification product and can
discriminate base pair differences in target DNA, such as mutations
(Cockerill, 2003; Wittwer and Kusukawa, 2004).
Absolute and relative quantification
Absolute quantification determines the exact number of the target present
in the sample, by relating the PCR signal to a standard curve, therefore
requiring that the absolute quantities of the standard be known. Absolute
quantification makes it easier to compare data from different assays and
necessary when exact transcript copy number need to be determined, e.g.
viral or bacterial load in microbiology clinics (Mackay, 2004; Livak and
Schmittgen, 2001).
The relative quantification method quantifies the target sequence
amount normalized to an endogenous reference control (Livak and
Schmittgen, 2001). This reference can be co-amplified separately or in the
same tube in a multiplex assay; therefore with this method, rather than
using a known amount of standard, comparison of the relative amount of
target sequence to the reference values is possible (Livak and Schmittgen,
2001). The result is given as relative to that reference value and reference
can be any transcript, as far as its sequence is known. Housekeeping genes
are often used for this purpose, as they are widely expressed in various cells
and tissues. The comparative Ct method is similar to the relative quantifica-
tion method, except the usage of arithmetic formulas to achieve results for
relative quantification. The relative standard or comparative Ct methods are
simpler and easier to establish than absolute quantification as well as
providing sufficient information in many cases. Details of quantification
methods are given in Chapters 3 and 6.
13.2.2 Bacteria
The real-time PCR systems brought significant advantages to clinical
microbiology. Real-time PCR applications are more sensitive, time and cost
effective for both detection and quantification of the pathogens and for
identification of the specific genes or mutations in microorganisms (Pahl et
al., 1999; Maeda et al., 2003; Boutaga et al., 2003; Saukkoriipi et al., 2004;
Sloan et al., 2004; Huletsky et al., 2004). Real-time PCR applications allow
222 Real-time PCR
fast confirmations of conventional detection and serology results, correc-
tion of non-specific serological false positive results, identification of the
genes that encode virulence factors or antimicrobial resistance, recognition
of the mutations of genes that are associated with antimicrobial resistance.
Thus, it may be possible to commence appropriate antibiotic therapy
sooner, or modify the therapy earlier in the presence of a molecular
identification from a culture-negative or serology-negative specimen, or
quantitative monitoring of the pathogen during therapy (Millar and Moore,
2004). Although not yet perfect, they have the potential to revolutionize
the way in which diagnostic tests are performed.
Bacterial detection and quantification
Rapid detection by real-time PCR has been an important advantage where
early diagnosis and appropriate antibiotic therapy are vital for survival,
and traditional methods are often time-consuming. For instance, the early
detection of bacterial DNA in the blood of critically ill patients with tradi-
tional culture diagnostic is still technically difficult (Cursons et al., 1999).
Real-time PCR assays have been developed for quantification of different
bacteria, including Chlamydia pneumoniae in human atherosclerotic
plaques (Ciervo et al., 2003), intestinal bacterial populations (Ott et al.,
2004) and Streptococcus pneumoniae in nasopharyngeal secretions
(Saukkoriipi et al., 2004). Helicobacter pylori is considered to be the major
causative agent of gastritis in acute or chronic forms and an important
factor for etiology of peptic ulcer and gastric cancer. Real-time PCR
technique based on the amplification of a fragment of the 23S rRNA gene
has been developed (Lascols et al., 2003). This system aimed at detecting H.
pylori directly from gastric biopsy specimens, quantifying the bacterial
density and testing the susceptibility of the strain to clarithromycin. Real-
time PCR also proved its high sensitivity for assessment of CagA protein,
which is one of the main virulence factors of H. pylori, as a diagnostic tool
for the pathogenity of H. pylori infection (Yamazaki et al., 2005). The detec-
tion of H. pylori colonization has been performed using a sensitive and
specific quantitative test based on the amplification of the fragment 26-
kDa Helicobacter-specific gene by real-time PCR (SYBR® Green I) and sensi-
tivity of the developed system is reported as five bacterial cells per PCR
sample (Mikula et al., 2003)
The protection of populations against a bioterrorism act has become a
major concern for the governments. For such threats, a rapid, specific and
sensitive detection of the microbial agent is of paramount importance.
Yersinia pestis, is enzootic in many countries and the causative agent for
bubonic plague, can be viewed as a potential biological weapon, according
to its ability to cause high rates of morbidity and mortality in humans, with
fatality rates of 50–100% if untreated (Brubaker, 1991). The intentional
dissemination of plague would most likely occur by aerosolization, causing
fulminant pneumonia in exposed individuals (Loiez et al., 2003). Out of 11
species of Yersinia, only three are pathogenic for humans. This may cause
false identification in commercially available biochemical identification
systems (Tomaso et al., 2003). With recently developed real-time PCR
systems for detection, identification and quantification of Yersinia pestis
Clinical microbiology 223
(Tomaso et al., 2003; Loiez et al., 2003), it is possible to achieve sensitive and
reliable results in rapid diagnosis of the pneumonic plague which is the
form of plague most likely to result from a biological warfare attack.
Real-time PCR has also improved the detection of Bacillus anthracis,
another potential biological terrorism tool. Bacillus anthracis is etiologic
agent for zoonotic disease anthrax, and recognized as a potential agent of
bioterrorism. Because of non-specific early symptoms of disease Bacillus
anthracis infection and diagnosing anthrax in humans is difficult (Makino
and Cheun, 2003). Identification of the organism in cultures, clinical speci-
mens and environmental samples are essential for ensuring that patients
infected with B. anthracis are treated as soon as possible (Ryu et al., 2003).
Therefore, detecting and monitoring anthrax spores in the environment,
especially in the air, can improve prognosis due to earlier initiation of thera-
pies and prevent spread of the infection. Routine culture and biochemical
testing methods are useful for the identification of Bacillus anthracis but it
takes 24 to 48 hours or longer (Bell et al., 2002). Conventional PCR-based
techniques were considered as a useful tool for detection of Bacillus
anthracis but they had limitations. Rapid-cycle real-time PCR instruments,
like LightCycler®, can be used for reliable and fast detection without carry-
over contamination (Makino and Cheun, 2003; Bell et al., 2002).
Examining antibiotic susceptibilities
Successful applications of real-time PCR have been developed for detection
of drug-resistant bacterial strains or antimicrobial testing of bacteria (Rolain
et al., 2004). Examples include Helicobacter pylori (Lascols et al., 2003),
Staphylococcus aureus (Huletsky et al., 2004), Enterecocci (Sloan et al., 2004),
Enterococcus faecalis and Enterococcus faecium (Woodford et al., 2002). One of
the most harmful human pathogens, Mycobacterium tuberculosis, may be
one of the best examples for underlining the importance of rapid antimi-
crobial susceptibility testing with real-time PCR. M. tuberculosis strains resis-
tant to anti-tuberculosis agents are being detected more frequently and
emergence of these strains threatens the capability of controlling the
disease worldwide (Wada et al., 2004). Approximately 3.2% of the new
tuberculosis cases are reported to be caused by multidrug-resistant strains of
M. tuberculosis (Viedma et al., 2003). Although the culture method still
remains as the gold standard for susceptibility testing, it takes at least two
weeks to get results (Wada et al., 2004). New real-time PCR systems for
detection and identification of multidrug-resistant M. tuberculosis strains
bring new opportunities to clinics for effective treatment of tuberculosis
(van Doorn et al., 2003, Rindi et al., 2003).
Detection of specific bacterial gene regions
The high sensitivity gained by real-time PCR allows detection of specific
gene or gene regions. Target-specific bacterial genes can be detected even
when they are present in very low concentrations, thus permitting detec-
tion and/or quantification of minor bacterial subpopulations, bacterial
mutations, and drug-resistance strains (Sloan et al., 2004; Costa et al., 2005).
Resistance in Mycobacterium tuberculosis is mostly conferred by point
224 Real-time PCR
mutations in genes coding for drug targets or drug-converting enzymes (van
Doorn et al., 2003; Rindi et al., 2003). The catalase peroxidase gene (katG) is
the most commonly targeted gene region for the detection of isoniazid-
resistance, with the majority of mutations occurring at codon 315 in
30–90% of isoniazid-resistant strains. Genotypic real-time PCR assays that
detect mutations within such regions are predictive of clinical drug resis-
tance and have potential to provide rapid detection of resistance in bacter-
ial isolates (Rindi et al., 2003). Recently developed real-time PCR genotypic
assays for detection of isoniazid resistance in Mycobacterium tuberculosis
simply detect the mutations C (-15) T and G (-24) T in the regulatory region
of the inhA gene (Rindi et al., 2003).
13.2.3 Fungi and parasites
Definitive diagnosis of fungal infections depends on a positive blood culture
or histopathological evidence of deep-tissue invasion but the sensitivity of
the blood culture, especially in invasive aspergillosis, is very low. Culture
techniques are also time-consuming, taking up to several weeks – an
unacceptable time for the initiation of specific treatment of fungal infection.
Alternative techniques to the traditional methods, such as enzyme linked
immunosorbent assay detection of the galactomannan antigen in serum and
bronchoalveolar lavage (BAL) fluid, and a plasma-β-D-glucan assay, have
recently been introduced. Although these techniques demonstrate good
sensitivity and varying degrees of specificity in high-risk patients, they may
only give positive results at advanced stages of the infection (Ascioglu et al.,
2002). Real-time PCR technology, however, is a simple, quick, highly specific
and sensitive method for the detection of infectious agents.
Besides fungal detection, quantification of the fungal burden is also
important in monitoring the effectiveness of treatment. Several investiga-
tors recently applied and showed the effectiveness of real-time PCR technol-
ogy. White et al. (2003) devised a method for rapid identification of 39
systemic infections with Candida species (within one working day) using
the LightCycler® real-time PCR system. Similarly, Aspergillus fumigatus DNA
in both BAL and blood samples from high-risk patients can be rapidly and
specifically detected and quantified by a LightCycler® based real-time PCR
assay (Spiess et al., 2003). Using an iCyler iQ® real-time PCR system,
pulmonary aspergillosis has been identified in over 90% of BAL samples of
high-risk patients (Sanguinetti et al., 2003). Several studies reported the
application of real-time PCR in susceptibility of Aspergillus and Candida
species to antifungal agents (Trama et al., 2005; Chau et al., 2004; Balashov
et al., 2005).
As one of the major infectious diseases in developing world, malaria has
also been targeted by rapid diagnostic testing by real-time PCR methods.
Lee et al., (2002) developed a TaqMan® real-time PCR technique for malaria
diagnosis that can be adapted for high-throughput rapid screening of
hundreds of samples during an outbreak to prevent further transmission of
malaria with a better sensitivity and specificity than those of the micro-
scopic method. The method is also shown to be useful in monitoring the
effectiveness of antimalarial therapy, especially in situations where drug-
resistant strains of the parasites are prevalent (Lee et al., 2002). Recently a
Clinical microbiology 225
single reaction real-time PCR assay has been described to detect and identify
all plasmodium species in 3 hours, including standard DNA sample prepa-
ration, amplification and detection, with sensitivities equivalent to
microscopy (Mangold et al., 2005).
The intestinal protozoan parasite Entamoeba histolytica is endemic in a
large part of the world and is considered responsible for millions of cases of
dysentery and liver abscess each year. Traditionally, the laboratory detec-
tion of E.histolytica in human feces has depended on the microscopic
examination of fresh stool samples. However, recently identified Entamoeba
dispar is a nonpathogenic type with no requirement of treatment and
cannot be differentiated morphologically from E. histolytica. In this regard,
Blessmann et al. (2002) developed a sensitive, specific and quick real-time
PCR method which can distinguish the two species. In another study using
multiplex real-time PCR, simultaneous detection of E. histolytica, Giardia
lamblia and Cryptosporidium parvum in fecal samples is successfully
performed (Verweij et al., 2004).
In conclusion, real-time PCR technology offers a sensitive, specific and
fast detection of fungal infections as well as parasites. Routine clinical appli-
cations of the technique in near future will result in the better control and
treatment of infectious diseases.
References
Al-Soud WA, Radstrom P (2001) Purification and characterisation of PCR-inhibitory
components in blood cells. J Clin Microbiol 39: 485–493.
Ascioglu S, Rex JH, de Pauw B, Bennett JE, Bille J, Crokaert F, Denning DW, Donnelly
JP, Edwards JE, Erjavec Z, Fiere D, Lortholary O, Maertens J, Meis JF, Patterson
TF, Ritter J, Selleslag D, Shah PM, Stevens DA, Walsh TJ (2002) Defining oppor-
tunistic invasive fungal infections in immunocompromised patients with
cancer and hematopoietic stem cell transplants: an international consensus.
Clin Infect Dis 1:34(1): 7–14
Balashov SV, Gardiner R, Park S, Perlin DS (2005) Rapid, high-throughput, multiplex,
real-time PCR for identification of mutations in the cyp51A gene of Aspergillus
fumigatus that confer resistance to itraconazole. J Clin Microbiol 43(1): 214–222.
Bell CA, Uhl JR, Hadfield TL, David JC, Meyer RF, Smith TF, Cockerill III FR (2002)
Detection of Bacillus anthracis DNA by LightCycler PCR. J Clin Microbiol 40(8):
2897–2902.
Blessmann J, Buss H, Nu PA, Dinh BT, Ngo QT, Van AL, Alla MD, Jackson TF, Ravdin
JI, Tannich E (2002) Real-time PCR for detection and differentiation of
Entamoeba histolytica and Entamoeba dispar in fecal samples. J Clin Microbiol
40(12): 4413–4417.
Boutaga K, van Winkellhoff AJ, Vandenbroucke-Grauls CMJE, Savelkoul PHM (2003)
Comparison of real-time PCR and culture for detection of Porphyromonas
gingivalis in subgingival plaque samples. J Clin Microbiol 41(11): 4950–4954.
Brubaker RR (1991) Factors promoting acute and chronic diseases caused by Yersinia.
Clinical Microbilogy Reviews 4: 309–324.
Chau AS, Mendrick CA, Sabatelli FJ, Loebenberg D, McNicholas PM (2004)
Application of real-time quantitative PCR to molecular analysis of Candida
albicans strains exhibiting reduced susceptibility to azoles. Antimicrob Agents
Chemother 48(6): 2124–2131.
Ciervo A, Petrucca A, Cassone A (2003) Identification and quantification of
Chlamydia pneumoniae in human atherosclerotic plaques by LightCycler real-
time PCR. Molecular and Cellular Probes 17: 107–111.
226 Real-time PCR
Cockerill FR (2003) Application of RapidCycle real-time polymerase chain reaction
for diagnostic testing in the clinical microbiology laboratory. Arch Pathol Lab
Med 127: 1112–1120.
Costa AM, Kay I, Palladino S (2005) Rapid detection of mecA and nuc genes in
staphylococci by real-time multiplex polymerase chain reaction. Diagnostic
Microbiology and Infectious Disease 51: 13–17.
Cursons RT, Jeyerajah E, Sleigh JW (1999) The use of polymerase chain reaction to
detect septicaemia in critically ill patients. Crit Care Med 27: 937–940.
Huletsky A, Giroux R, Rossbach V, Gagnon M, Vaillancourt M, Bernier M, Gagnon F,
Truchon K, Bastien M, Picard FJ, van Belkum A, Ouellette M, Roy PH, Bergeron
MG (2004) New real-time PCR assay for rapid detection of methicillin-resistant
staphylococcus aureus directly from specimens containing a mixture of staphy-
lococci. J Clin Microbiol 42(5): 1875–1884.
Jansson JK, Prosser JI (1997) Quantification of the presence and activity of specific
microorganisms in nature. Molecular Biotechnology 7(2): 103–120.
Lascols C, Lamarque D, Costa JM, Copie-Bergman C, Le Glaunec JM, Deforges L,
Soussy CJ, Petit JC, Delchier JC, Tankovic J (2003) Fast and accurate quantitative
detection of Helicobacter pylori and identification of Clarithromycin resistance
mutations in H. pylori Isolates from gastric biopsy specimens by real-time PCR.
J Clin Microbiol 41(10): 4573–4577.
Lee MA, Tan CH, Aw LT, Tang CS, Singh M, Lee SH, Chia HP, Yap EP (2002) Real-time
fluorescence-based PCR for detection of malaria parasites. J Clin Microbiol
40(11): 4343–4345.
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-
time quantitative PCR and the 2–ΔΔCt method. Methods 25: 402–408.
Loiez C, Herwegh S, Wallet F, Armand S, Guinet F, Courcol RJ (2003) Detection of
Yersinia pestis in sputum by real-time PCR. J Clin Microbiol 41(10): 4873–4875.
Mackay IM (2004) Real-time PCR in the microbiology laboratory. Clin Microbiol Infect
10: 190–212.
Maeda H, Fujimoto C, Haruki Y, Maeda T, Kokeguchi S, Petelin M, Arai H, Tanimoto
I, Nishimura F, Takashiba S (2003) Quantitative real-time PCR using TaqMan
and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas
gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol
Med Microbiol 39(1): 81–86.
Makino S, Cheun H (2003) Application of the real-time PCR for the detection of
airborne microbial pathogens in reference to the anthrax spores. J Microbiol
Methods 53: 141–147.
Mangold KA, Manson RU, Koay ES, Stephens L, Regner M, Thomson RB Jr, Peterson
LR, Kaul KL (2005) Real-time PCR for detection and identification of
Plasmodium spp. J Clin Microbiol 43(5): 2435–2440.
Mikula M, Dzwonek A, Jagusztyn-Krynicka K, Ostrowski J (2003) Quantitative detec-
tion for low levels of Helicobacter pylori infection in experimentally infected mice
by real-time PCR. J Microbiol Methods 55(2): 351–359.
Millar BC, Moore JE (2004) Molecular diagnostics. current options. FROM: methods in
molecular biology. In: 266: Genomics, proteomics, and clinical bacteriology:
methods and reviews. Woodford N, Johnson A (eds) Humana Press Inc., Totowa, NJ.
Monteiro L, Bonnemaison D, Vekris A, Petry KG, Bonnet J, Vidal R, Cabrita J,
Megraud F (1997) Complex Polysaccharides as PCR Inhibitors in Feces: Helyco-
bacter pylori model. J Clin Microbiol 35(4): 995–998.
Nolte FS (2004) Novel internal controls for real-time PCR assays. Clinical Chemistry
50(5): 801–802.
Ott SJ, Musfeldt M, Ullmann U, Hampe J, Schreiber S (2004) Quantification of
intestinal bacterial populations by real-time PCR with a universal primer set to
minor groove binder probes: a global approach to the enteric flora. J Clin
Microbiol 42(6): 2566–2572.
Clinical microbiology 227
Pahl A, Kuhlbrandt U, Brune K, Rollinghoff M, Gessner A (1999) Quantitative detec-
tion of Borrelia burgdorferi by real-time PCR. J Clin Microbiol 37(6): 1958–1963.
Rindi L, Bianchi L, Tortoli E, Lari N, Bonanni D, Garzelli G (2003) A real-time PCR
assay for detection of isoniazid resistance in Mycobacterium tuberculosis clinical
isolates. Journal of Microbiological Methods 55: 797–800.
Rolain JM, Mallet MN, Fournier PE, Raoult D (2004) Real-time PCR for universal
antibiotic susceptibility testing. Journal of Antimicrobial Chemotherapy 54:
538–541.
Ryu C, Lee K, Yoo C, Seong WK, Oh HB (2003) Sensitive and rapid quantitative
detection of anthrax spores isolated from soil samples by real-time PCR.
Microbiol Immunol 47(10): 693–699.
Sanguinetti M, Posteraro B, Pagano L, Pagliari G, Fianchi L, Mele L, La Sorda M,
Franco A, Fadda G. Comparison of real-time PCR, conventional PCR, and galac-
tomannan antigen detection by enzyme-linked immunosorbent assay using
bronchoalveolar lavage fluid samples from hematology patients for diagnosis of
invasive pulmonary aspergillosis. J Clin Microbiol 41(8): 3922–3925.
Saukkoriipi A, Leskela K, Herva E, Leinonen M (2004) Streptococcus pneumoniae in
nasopharyngeal secretions of healthy children:comparison of real-time PCR and
culture from STGG-transport medium. Molecular and Cellular Probes 18:
147–153.
Sintchenko V, Iredell JR, Gilbert GL (1999) Point of view: is it time to replace the
petri dish with PCR? Application of culture-independent nucleic acid ampli-
fication in diagnostic bacteriology: Expectations and reality. Pathology 31:
436–439.
Sloan LM, Uhl JR, Vetter EA, Schleck CD, Harmsen WS, Manahan J, Thompson RL,
Rosenblatt JE, Cockerill III FR (2004) Comparison of the LightCycler van A/van
B detection assay and culture for detection of vancomycin-resistant entereo-
cocci from perianal swabs. J Clin Microbiol 42(6): 2636–2643.
Spiess B, Buchheidt D, Baust C, Skladny H, Seifarth W, Zeilfelder u, Leib-Mosch C,
Morz H, Hehlmann R (2003) Development of a LightCycler PCR assays for detec-
tion and quantification of Aspergillus fumigatus DNA in clinical samples from
neutropenic patients J Clin Microbiol 41(5): 1811–1818.
Tomaso H, Reisinger EC, Al Dahouk S, Frangoulidis D, Rakin A, Landt O, Neubauer
H (2003) Rapid detection of Yersinia pestis with multiplex real-time PCR assays
using fluorescent hybridisation probes. FEMS Immunol Med Microbiol 38(2):
117–126.
Trama JP, Mordechai E, Adelson ME (2005) Detection of Aspergillus fumigatus and a
mutation that confers reduced susceptibility to itraconazole and posaconazole
by real-time PCR and pyrosequencing. J Clin Microbiol 43(2): 906–908.
van Doorn HR, Claas ECJ, Templeton KE, van der Zanden AGM, Vije AK, Jong MD,
Dankert J, Kuijper EJ (2003) Detection of a point mutation associated with high-
level isoniazid resistance in Mycobacterium tuberculosis by using real-time PCR
technology with 3’-minor groove Binder-DNA probes. J Clin Microbiol 41(10):
4630–4635.
Verweij JJ, Blange RA, Templeton K, Schinkel J, Brienen EA, van Rooyen MA, van
Lieshout L, Polderman AM (2004) Simultaneous detection of Entamoeba histo-
lytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using
multiplex real-time PCR. J Clin Microbiol 42(3): 1220–1223.
Viedma G (2003) Rapid detection of resistance in Mycobacterium tuberculosis: a review
discussing molecular approaches. Clinical Microbiol Infect 9: 349–359.
Wada T, Maeda S, Tamaru A, Imai S, Hase A, Kobayashi K (2004) Dual-Probe assay for
rapid detection of drug-resistant Mycobacterium tuberculosis by real-time PCR.
J Clin Microbiol 42(11): 5277–5285.
White PL, Shetty A, Barnes RA (2003) Detection of seven Candida species using the
Light-Cycler system. J Med Microbiol 52(Pt 3): 229–238.
228 Real-time PCR
Wittwer CT, Kusukawa N (2004) Real-time PCR. In: Persing DH, Tenover FC,
Versalovic J, Tang YW, Unger ER, Relman DA, White TJ (eds). Diagnostic molec-
ular microbiology; principles and applications. ASM Press, Washington, DC,
71–84.
Woodford N, Tysall L, Auckland C, Stockdale MW, Lawson AJ, Walker RA, Livermore
DM (2002) Detection of oxazolidinone-resistant Enterococcus faecalis and
Enterococcus faecium strains by real-time PCR and PCR-restriction fragment
length polymorphism analysis. J Clin Microbiol 40(11): 4298–4300.
Yamazaki S, Kato S, Matsukura N, Ohtani M, Ito Y, Suto H, Yamazaki Y, Yamakawa
A, Tokudome S, Higashi H, Hatakeyama M, Azuma T (2005) Identification of
Helicobacter pylori and the cagA genotype in gastric biopsies using highly sensi-
tive real-time PCR as a new diagnostic tool. FEMS Immunology and Medical
Microbiology 44(3): 261–268.
Clinical microbiology 229
Protocol 13.1: Detection
of Prevotella intermedia
by real-time PCR assay
Sample preparation
After removal of supragingival plaque above the gingival line, isolate the
sampling sites with sterile cotton roll, and then air-dry.
Remove the subgingival plaque samples from the deepest pockets from the
same patients with individual sterile Gracey curettes.
Immerse the plaque sample in 1.0 ml PBS (-) (GibcoBRL, MD, USA), and
vortex for 30 sec, followed by centrifugation for 20 min at 15,000 g. Remove
the supernatant.
Extract the bacterial DNA from cultivated strains and clinical plaque samples
by using InstaGene® Matrix (Bio-Rad Lab., CA, USA), according to manufac-
turer’s instructions.
Oligonucleotides
For the identification of unique bacterium, primers designed from the species-
specific region on the 16S rDNA are used, based on their known 16S rDNA
sequences (GenBank). The sequences of primers for real-time PCR can be
designed by using Primer Express® (Applied Biosystems) and OLIGO Primer
Analysis Software (Version 4.0, Molecular Biology Insights, Inc.).
One set of primer sequences for amplification of Prevotella intermedia are as
follows:
Forward 5’-AATACCCGATGTTGTCCACA -3’
Reverse 5’-TTAGCCGGTCCTTATTCGAA -3’
For specificity testing of primers, extracted DNAs from 107 cells of Prevotella
intermedia can be examined as templates with the primers. PCR amplifications
should be observed when the target strains are used as templates. There should
be no increase in the fluorescence with the mismatch strains. Melting curves of
all PCR products should show sharp peaks at the expected Tm of the products.
These preliminary results indicate that each real-time PCR specifically amplified
the target DNA.
Reaction mixture
The total volume used in this protocol is 50 μl, however if necessary, each
reaction can be made in a total volume of 25 μl maintaining the correct concen-
trations of reagents:
230 Real-time PCR
2 × SYBR® Green Master Mix 26.0 μL
Forward primer (10 μM) 2.0 μL
Reverse primer (10 μM) 2.0 μL
Molecular biology grade H2O 15.0 μL
Specimen or control nucleic acid extract 5.0 μL
Total 50.0 μL
Carefully pipette the reaction mixture into wells of MicroAmp® Optical 96-well
Reaction Plate (Applied Biosystems). Use 107–102 cell dilutions of P. intermedia
to make a standard curve in each individual reaction plate and use 5 μL of
molecular biology grade H2O as negative control. Add 5 μL DNA in each sample
well.
Place the reaction plate into GeneAmp® 5700 Sequence Detection System (PE
Applied Biosystems).
Cycling conditions
Thermocycling program for this pair of primers consists of 40 cycles of 95°C for
15s and 60°C for 1 min with an initial cycle of 95°C for 1 min. Accumulations of
the PCR products are detected in each cycle by monitoring the increase in
fluorescence of the reporter dye double-strand DNA-binding SYBR® Green.
Analysis
Dissociation curve (melting curve, Tm) analysis should be performed within the
temperature range of 60°C to 95°C to detect specific amplification of the target
sequence. GeneAmp® 5700 SDS software (PE Applied Biosystems) can be used
for melting curve analysis. Details of melting analysis are provided in Chapter 9.
Clinical virology
David M. Whiley and Theo P. Sloots 14
14.1 Introduction
There has been a marked improvement in the diagnosis of viral infections
over the last decade with the application of the polymerase chain reaction
(PCR), and more recently real-time PCR. The employment of real-time PCR
for virus detection offers the advantage of high sensitivity and repro-
ducibility combined with an extremely broad dynamic range. However, the
greatest impact of real-time PCR has undoubtedly been its ability to
quantify the viral load in clinical specimens. The results can be expressed in
absolute terms with reference to quantified standards, or in relative terms
compared to another target sequence present in the sample. In addition,
quantitative PCR (qPCR) tests offer the possibility to determine the dynam-
ics of viral proliferation, monitor the response to treatment, and distinguish
between latent and active infections.
Many qPCR protocols for the detection of viral targets have now been
published and commercial assays are available for a number of clinically
important viruses, including human immunodeficiency virus (Kumar et al.,
2002; O’Doherty et al., 2002), hepatitis B and C viruses (Berger et al., 1998),
and cytomegalovirus (Boeckh and Boivin, 1998). However, the number of
commercial assays available is still limited and this has led to the develop-
ment and introduction of in-house real-time qPCR protocols.
Current approaches to the development of viral real-time PCR assays
commonly employ fluorescent chemistry to effect the kinetic measurement
of product accumulation. These may include non-specific compounds such
as the DNA intercalating dye SYBR® Green or sequence specific oligoprobes
which employ fluorescent resonance energy transfer (FRET). In practice, our
experience has been that the specific approach has yielded better results for
the detection of viral pathogens in clinical specimens, and particularly so in
the determination of viral loads.
Recently, technical improvements in sequence detection systems have
enabled extensive characterization of the viral genome, including determi-
nation of viral subtype, genotype, variants mutants and genotypic resis-
tance patterns. However, such characterization has demonstrated that
many regions of the viral genome are heterogeneous, displaying sequence
variation not only between genera, but also variants of the same virus
isolated at a single geographic location. Such variation has profound impli-
cations for the design of sensitive and specific real-time PCR protocols,
particularly for RNA viruses where genomic polymorphism is widespread.
Also, in order to obtain meaningful results, it is important that the
efficiency of the PCR does not vary greatly due to minor differences
232 Real-time PCR
between samples, and careful optimization of the PCR conditions are
required to obtain consistent results. This is particularly important in the
design and performance of qPCR. Even so, other factors, inherent to the
target virus, also can affect the results of qPCR. Recent studies in our labora-
tory have demonstrated that sequence variation in the primer or probe
target sites has a significant and major impact of the validity of qPCR results
in determining viral load (Whiley and Sloots, 2005b). This chapter will
examine the effect of sequence variation of primer and probe target sites on
assay performance, and its effect on quantification of viral loads.
14.2 Qualitative real-time PCR for viral disease
14.2.1 Sequence variation and assay performance
It must be recognized that the success of any real-time PCR assay is highly
dependent on the nature of the primer and probe target sequences utilized
in the assay. These sequences need to be specific for the target virus and
must be well conserved across different strains or types of the virus, other-
wise the sensitivity of the assay may be compromised. However, for many
viruses it can be difficult to identify such sequences. There are several
reasons for this, including sequence polymorphism of the viral genome, a
lack of sequence information as well as perceived changes in the clinical
relevance of certain viral subtypes. Parainfluenza virus type 3, respiratory
syncytial virus, human metapneumovirus, and influenza virus A provide
good examples of this phenomenon.
Sequence polymorphism and false-negative results
Sequence polymorphism occurs throughout the genomes of many viruses,
and any one viral species can comprise multiple genotypes exhibiting
considerable sequence variation. Furthermore, within any single patient
population or between different populations different strains of a viral
species may circulate. If polymorphism occurs in the primer or probe target
sites on the viral genome, then the PCR assay may have a lower sensitivity
in its ability to detect these strains or at worse fail to detect the virus strain
altogether.
Recently, we compared a 5’ nuclease assay targeting the parainfluenza 3
nucleocapsid protein gene (WhSl-para3–5N; unpublished data) with a
previously described 5’ nuclease assay targeting the parainfluenza 3 hemag-
glutinin-neuraminidase gene (HN-para3–5N; Watzinger et al., 2004) for the
detection of parainfluenza 3 in nasopharyngeal aspirate specimens
collected from a local patient population. During the course of the study, 34
positive samples were identified with both assays detecting 33 of these. The
cycle threshold (Ct ) values for these 33 positive samples were comparable in
both assays, with an average difference of only 1.1 cycles. However, one
sample was negative by the WhSl-para3–5N assay but was positive by the
HN-para3–5N assay, providing a Ct value of 25. Such a low Ct value
indicates that the viral load was relatively high in this specimen and there-
fore the false-negative result could not be explained by the differences in
the detection limit of each assay. The presence of parainfluenza 3 in this
Clinical virology 233
specimen was confirmed by a direct fluorescence assay (DFA), yet the speci-
men consistently provided negative results in the WhSl-para3–5N assay.
Sequencing of the viral genome that was targeted by the TaqMan® probe
showed four mismatches. These were almost certainly responsible for the
false-negative result (see Troubleshooting guide 14.1).
The WhSl-para3–5N assay was designed using the parainfluenza 3
sequences for the nucleocapsid protein gene currently available on the
Genbank sequence database. Based on this information, the primer and
probe targets appeared to be well conserved and certainly the mismatches
identified above were not represented in Genbank sequences. Quite simply,
this demonstrates that the use of sequence information from public
databases has limitations for viral assay design. Furthermore, the above
results highlight that sequence polymorphism between viral strains circu-
lating in a population can lead to false-negative results in PCR assays, and
that these results may occur irrespective of viral load. Overall, our experi-
ence indicates that sequence variation is a more widespread problem for the
design and performance of viral PCR assays. However, the occurrence of
false-negative results due to sequence variation can usually be identified by
the use of a second assay and confirmed by gene sequencing.
Sequence polymorphism and fluorescent response
The impact of sequence variation upon real-time PCR assays is not simply
restricted to producing false-negative results, but can have more subtle
effects, including the reduction of the overall fluorescent signal produced in
an assay. Recently, we developed a real-time PCR for the detection of
respiratory syncytial virus (RSV) using a 3’ minor groove binder (MGB)
TaqMan® probe. These MGB probes are particularly suited for the detection
of single nucleotide polymorphisms (Kutyavin et al., 2000). However, they
are also quite useful where only limited target sequence is available, given
their shorter length compared to standard DNA TaqMan® probes. It is for
the latter reason that we designed a MGB probe or the detection of respira-
tory syncytial virus sequences. This RSV MGB assay used RSV L-gene
sequences available on the Genbank public database. Based on these
sequences, two primers (forward AGTAGACCATGTGAATTCCCTGC;
reverse GTCGATATCTTCATCACCATACTTTTCTGTTA) and one MGB probe
(FAM-TCAATACCAGCTTATAGAAC-MGB-BHQ1) were designed.
During the initial evaluation of the assay, significant differences were
observed between the linear amplification curves produced by positive
specimens. In particular, the fluorescent signal for some positive specimens
deviated only slightly from the baseline fluorescence (see Figure 14.2).
Sequence analysis of the amplification products from several of these
positives samples showing varying fluorescent signal revealed that
mismatches with the MGB probe were responsible for the differences in
fluorescence (see Troubleshooting guide 14.2). Briefly, no mismatches
between the target and MGB probe gave an optimal fluorescent signal,
whereas a single mismatch significantly lowered the fluorescent signal, the
extent of which was dependent on where the mismatch occurred. Notably,
specimens providing the lowest fluorecent signal had a mismatch nearer
the 3’ end of the MGB probe (Whiley and Sloots, 2006.)
234 Real-time PCR
These results highlight the usefulness of MGB TaqMan® probes for the
detection of mismatches. However, they suggest that MGB TaqMan®
probes may have limited utility for viral diagnostics, particularly where the
probes are used to screen for uncharacterized viral strains. It should be
noted that we have been using standard DNA TaqMan® probes for many of
our respiratory virus assays and have not observed similar differences in
fluorescent signal. As a result, our laboratory now preferentially adopts
standard DNA TaqMan® probes, rather than MGB TaqMan® probes, for
routine viral screening.
Limited sequence information and assay development
The issues concerning sequence variation can be further complicated by the
fact that sequence information on public databases may comprise only a
limited number of viral strains usually from discrete geographic locations.
Therefore, the development of PCR assays based on such limited informa-
tion may affect the sensitivity of assay performance. This can be most
pronounced for newly detected viruses. Following the initial characterisa-
tion of human metapneumovirus (van den Hoogen et al., 2001), our labora-
tory developed a PCR assay to detect this virus in clinical specimens. This
assay used a 5’ nuclease probe targeting the nucleocapsid protein gene
(hMPV-N-5N; Mackay et al., 2003), and was developed using the limited
sequence data present on Genbank at the time. However, subsequent studies
revealed that human metapneumovirus comprised at least four genetic
lineages (A1, A2, B1 and B2) with considerable sequence variation between
these lineages (van den Hoogen et al., 2004). As a result we found that the
hMPV-N-5N assay failed to detect some human metapneumovirus strains of
the B lineage. Sequencing revealed that mismatches were present between
the primers and probe and the nucleocapsid gene sequences of some human
metapneumovirus B viral strains, and that these were responsible for the
limitations of the hMPV-N-5N assay. Subsequently another hMPV 5’ nucle-
ase assay targeting the human metapneumovirus nucleocapsid protein gene
was described by Maertzdorf et al., (2004), and reportedly was capable of
detecting human metapneumovirus from all known genetic lineages. We
have since used this assay for the detection of human metapneumovirus
lineage B strains in our local patient population. Overall, the initial limita-
tions of our hMPV-N-5N assay was entirely due to the fact that the assay was
designed using limited sequence data available on Genbank at the time, and
predominantly comprised human metapneumovirus type A sequences.
The changing clinical significance of influenza A subtypes
In recent years, influenza type A has provided a good example of the
challenges confronting real-time PCR detection of viral agents comprising
genetically heterogeneous populations. Influenza A exists as multiple sub-
types showing considerable sequence variation between and within subtypes.
However, the problems concerning the PCR detection of influenza A are not
due to a lack of available sequence information. Genbank, for example,
contains an extensive amount of sequence data for numerous genes from a
wide range of viral subtypes representing various regions around the world.
Clinical virology 235
Rather, the recent problems concerning PCR detection of influenza A have
involved a change in the genetic nature of the viral subtypes circulating in a
population. Following the Hong Kong pandemic of 1968, the influenza A
types infecting humans have remained fairly stable with the common
subtypes causing disease including H1N1, H1N2, H2N2 and H3N2. As a
consequence, numerous PCR assays have been developed to ensure the detec-
tion of these subtypes. However, in the late 1990s avian strains of influenza
were shown to infect humans (Hammel and Chiang, 2005), and several
incidents of infection were reported, including H5N1, H7N2, H7N3, H7N7,
and H9N2, in countries including Canada, the United States, the Netherlands
as well as numerous Asian countries. Established PCR protocols were unable
to detect these avian strains due to the genetic heterogeneity of their
genomes, and, consequently, there was a growing need to review diagnostic
capabilities for influenza A in many countries.
These limitations of the established PCR protocols were addressed by the
development of a conventional PCR assay capable of detecting influenza A
viruses from multiple animal species (Fouchier et al., 2000). More recently,
our laboratory developed a 5’ nuclease real-time RT-PCR (WhSl-FluA-5N;
protocol 1) for the detection of both the common human influenza A subtypes
as well as the avian subtypes now known to infect humans. To validate our
WhSl-FluA-5N assay, it was compared to a previously described influenza A 5’
nuclease RT-PCR assay (FluA-TM; van Elden et al., 2001), which also targeted
the influenza A matrix protein gene. Overall, the results showed good agree-
ment between the two assays when applied to the detection of influenza type
A in nasopharyngeal aspirate samples obtained from patients in our local
Australian population. However, the WhSl-FluA-5N assay could detect a
greater number of influenza A subtypes than the FluA-TM.
Briefly, nucleic acids were extracted from 23 influenza type A cultures
comprising subtypes H1N1 (6 strains), H3N2 (12), H5N1 (2), H5N3 (1),
H7N7 (1), and H9N2 (1), and were tested by both assays. All H1N1 and
H3N2 strains were detected by both assays, whereas, the H5N1, H5N3,
H7N7, and H9N2 strains were positive by the WhSl-FluA-5N assay only
(Whiley and Sloots, submitted for publication). It should be noted that the
FluA-TM assay has been used successfully in our laboratory for the detection
of influenza A for a number of years, and only recently have we adopted the
WhSl-FluA-5N assay given the potential introduction of avian strains into
our population.
On the whole, the above results highlight that the range of influenza A
subtypes affecting humans can change and that, given the sequence varia-
tion existing between such subtypes, laboratory diagnostic assays need to be
reviewed as new subtypes infecting humans are identified. Potentially, the
use of the WhSl-FluA-5N assay may need to be reassessed if other influenza
A subtypes are identified or if genomic sequence variation of local strains
leads to mismatches in the primer or probe target sites.
Additional comments
It should be noted that the successful validation of a PCR assay against
specimens collected from any one patient population at a particular time
may give only limited indication to the performance of that assay in
236 Real-time PCR
another patient population, or even on the same patient population at a
different time. Essentially this is due to differences and mutation of circu-
lating viral strains in those populations, and highlights the need for assay
validation on virus populations that represent local virus types and
subtypes. Following validation there is then a clear need for ongoing quality
control of assay performance.
Many of the limitations due to sequence variation can often be compli-
cated by a lack of sequence information for local viral subtypes during assay
development. This may be overcome by laboratories conducting their own
sequencing studies, but this increases assay development costs consider-
ably, as a broad range of viral strains need to be sequenced to provide
adequate information. In general, we use sequence information on public
databases as a tentative guide only and develop two PCR assays, targeting
different genes, which are then evaluated in parallel.
Although these issues highlight some notable pitfalls concerning the
application of molecular assays in viral diagnostics, they detract from the
enormous potential of PCR over traditional techniques, such as DFA and
virus isolation by cell culture. The major benefit of PCR is its potential for
greater sensitivity and specificity compared to the traditional methods. We
believe there is a need for acceptance that some viral strains may be missed
by PCR in the same manner that the traditional methods may fail to detect
low viral loads or non-viable organisms. Nonetheless, the problems
concerning strain variation may be overcome by using two PCR assays with
different gene targets in parallel, although this would inevitably increase
the cost of testing.
14.3 Virus typing using sequence-specific probes
An additional advantage of real-time PCR technology in viral diagnostics is
its ability to detect and characterize viral types simultaneously within a
single reaction, thereby further reducing cost and hands-on time. In our
laboratory, two formats have been adopted for virus typing. These are
consensus hybridization probes combined with melting curve analysis, and
type-specific TaqMan® probes labeled with different fluorophores.
14.3.1 Hybridization probes
The use of hybridization probes with melting curve analysis provides signif-
icant benefits for diagnostic virology. The approach adds an extra element
of specificity to any viral PCR assay. This is because mismatches with the
probes will decrease the melting temperature of the hybridization complex
formed between the probes and the PCR product during melting curve
analysis. The extent of this decrease is dependent on the number and
position of the mismatches with the probes. This may serve as a quality
control mechanism, where shifts in observed melting temperature from
that of expected melting temperature are indicative of sequence variation
within the target and may warrant further investigation of the assay perfor-
mance. On the other hand, such shifts in melting temperature can be
advantageous, enabling characterization and typing of two closely related
viruses. Briefly, this involves designing a set of hybridization probes capable
Clinical virology 237
of hybridizing to both viral types, but having a limited and defined number
of mismatches with the DNA of one type and no mismatches with the other
type. It is these mismatches and subsequent difference in melting tempera-
ture that then enable the two viruses to be distinguished during melting
curve analysis.
To date, we have used hybridization probe protocols coupled with
melting curve analysis for the routine detection and differentiation of
herpes simplex virus (HSV) types 1 and 2 and human polyomaviruses JC
and BK (JCV and BKV). Overall, the assays have high clinical sensitivity and
specificity. However, two limitations have become evident. First, sequence
variation within the viral types can interfere with virus characterization,
and second, the assays can fail to detect one viral type when both are
present in a single sample (Whiley and Sloots, 2005a).
The effect of sequence variation in hybridization probe target
sites
The herpes simplex virus PCR assay initially used in our laboratory was the
LightCycler® hybridization probe method originally described by Espy et al.,
(2000), using an asymmetric primer concentration for the improved resolu-
tion of melting temperatures (Protocol 2). Briefly, the assay targets the
herpes simplex virus DNA polymerase gene and works on the basis that
both hybridization probes are complementary to target sequences on the
herpes simplex virus type 2 DNA genome. However, one of the probes has
two mismatches with herpes simplex virus type 1 DNA target sequences,
thereby theoretically lowering the melting temperature for herpes simplex
virus type 1 by approximately 7°C. In applying this method we found that
the majority of our local herpes simplex virus strains can be differentiated
as herpes simplex virus 1 or 2, but that approximately 5% of herpes simplex
virus positive specimens produce melting temperatures that are not charac-
teristic of either the type 1 or 2 melting curves. Sequence analysis of the PCR
products from several of these problematic samples revealed unexpected
sequence variation in the probe binding sites, which was responsible for the
uncharacteristic melting temperatures. In particular, a range of melting
temperatures was observed for herpes simplex virus type 2 strains circulat-
ing in our local population, all attributable to polymorphism of the probe
binding sites. (see Figure 14.3 and Troubleshooting guide 14.3; Whiley et al.,
2004)
To circumvent the problems associated with sequence variation of our
local viral strains, our laboratory developed a herpes simplex virus
hybridization probe (LightCycler®) assay targeting the glycoprotein D gene
(Whiley et al., 2004). The assay proved to be more successful for character-
izing our local herpes simplex virus strains, yet recently variations in
melting temperature have again been observed using this assay in a small
number of herpes simplex virus positive samples (unpublished data).
Overall, this suggests that the use of hybridization probes for herpes
simplex virus genotyping could be inherently problematic due to genomic
sequence variation between viral strains. This is supported by other studies
(Anderson et al., 2003; Smith et al., 2004). Smith et al., (2004) has empha-
sized that polymorphism occurs throughout the herpes simplex virus
238 Real-time PCR
genome and has recommended that at least two real-time PCR assays be
used for accurate typing of herpes simplex virus strains.
Interestingly, our laboratory has used a polyomavirus hybridization
probe assay for a number of years, yet no shifts in melting temperature have
been observed for our local JCV or BKV strains. However, the number of
herpes simplex virus -positive samples detected greatly exceeds those for
polyomavirus, and similar sequence variation may yet be detected in the
future, as sequencing studies have revealed that polymorphism does occur
near the primer and probe target sites of the assay in our locally circulating
polyomavirus strains. Therefore, the fact that melting shifts have not yet
been observed in the polyomavirus assay may merely be a statistical
anomaly (Whiley and Sloots, 2005a).
The presence of two viral types
Another serious limitation of melting curve analysis is the potential failure
to detect two viral types when both are present in a single specimen. This
was observed in the polyomavirus hybridization probe assay when the
results were compared to those from a conventional PCR using JCV and
BKV specific probes (Whiley et al., 2001). In the validation process, both
assays provided 100% agreement in detecting the presence of
polyomaviruses in urine samples. However, the hybridization probe assay
failed to detect the presence of both JCV and BKV in three of five specimens
containing both viral types. Our subsequent results show that the relative
viral loads of JCV and BKV in a single sample need only differ by one log for
the assay to fail in the detection of both viruses (Whiley and Sloots, 2005a).
Similar observations were also made for specimens collected from patients
dually infected with HSV 1 and HSV 2. Recently, we compared the HSV
hybridization probe-based assay, targeting the HSV glycoprotein D gene
(Whiley et al., 2004), with a previously described nuclease probe (TaqMan®)
duplex real-time PCR assay, utilizing HSV type-specific primers and probes also
targeting the glycoprotein D gene (Weidmann et al., 2003). Briefly, this inves-
tigation tested 10-fold dilutions of HSV type 2 spiked with HSV type 1 DNA
(see Table 14.1). Overall, the duplex TaqMan® assay provided significantly
Table 14.1 Ten-fold dilutions of HSV type 2 DNA, spiked with HSV type 1
DNA, tested in the D glycoprotein gene hybridization probe and duplex
TaqMan® assays.
Dilutions 1 2 3 4 5 6
Copies of HSV type 2 107 106 105 104 103 102
Copies of HSV type 1 104 104 104 104 104 104
Results:
Hybridization probe assay
HSV type 2 POS POS POS POS POS neg
HSV type 1 neg neg POS POS POS POS
Duplex TaqMan® assay
HSV type 2 POS POS POS POS POS POS
HSV type 1 POS POS POS POS POS POS
neg = negative, POS = positive
Clinical virology 239
better discriminatory power, detecting the presence of both viruses in all
dilutions. The results of the HSV hybridisation probe assay largely reflected
those previously observed for the polyomavirus assay, and in three of six speci-
mens, only the HSV type at the higher concentration was detected whereas
both types were detected where the relative loads were within one log.
14.3.2 Additional comments
Failure to detect the presence of certain viral types can have a significant
impact on patient management. For example, in transplant patients early
detection of BK virus (BKV) reactivation is important as this is often the
precursor to BKV associated disease, including hemorrhagic cystitis.
Notably JCV and BKV are often shed simultaneously in human urine.
Therefore, the presence of JCV strains or otherwise sequence polymorphism
of the target binding sites could confound the detection of BKV in the urine
of transplant patients, reducing the potential to predict the onset of disease.
Co-infections of HSV types 1 and 2 are less common and the failure to
detect one of these viruses is arguably of little importance to clinical
management and treatment. Nonetheless, incorrect typing of HSV can have
significant psychological and social implications, even though the clinical
management of the patient is unaffected.
These issues highlight the limitations of hybridization probes used in
melting curve analysis for viral characterization in a clinical setting. If the
accurate identification of a specific virus type carries clinical importance
then careful consideration must be given to the detection methods used in
the assay. Preferably, such formats should not rely on consensus oligonu-
cleotide sequences but use type-specific primers and probes.
14.4 Quantification of viral load
Quantitative PCR analysis of viral nucleic acid is now used by diagnostic
laboratories worldwide and is particularly useful for monitoring viral loads in
patients to assess the effect of anti-viral therapy and potentially to detect drug-
resistant viral strains. In clinical virology, qPCR is commonly used for the
detection and quantification of blood-borne viruses, including hepatitis B and
C and human immunodeficiency viruses. However, it is also increasingly used
to monitor viral pathogens of transplant patients, including Epstein–Barr
virus, cytomegalovirus and BK virus. In recent years, our laboratory has used
quantitative real-time PCR to investigate BK viral loads in a transplant patient
population (see Protocol 14.3). BKV can cause several clinical manifestations in
immunocompromised patients including hemorrhagic cystitis and allograft
nephropathy. Since adopting qPCR, several limitations of this technology
have been identified, including the impact of PCR inhibitors, poor nucleic acid
extraction and the effect of sequence variation in PCR primer target sites. Each
one of these will impact upon the accuracy of the qPCR results.
14.4.1 The use of an internal control in clinical molecular virology
As discussed in previous chapters, the generation of accurate qPCR results is
dependent on the strict control and standardization of many assay
240 Real-time PCR
processes. In qPCR applied to clinical virology, the main sources of error
include the nucleic acid isolation process and the presence of PCR
inhibitors in clinical specimens. In our opinion, the best way to control for
these factors is by using an internal control strategy previously described by
Niesters (2004). Briefly, this involves spiking specimens and standards prior
to extraction with a known concentration of an unrelated virus, in this case
seal herpesvirus (PhHV-1), which is then extracted with the test specimen.
The specimen extracts are subsequently each tested by a PhHV-1 TaqMan®
assay and the Ct values compared to a predetermined range of Ct values.
Specimens providing Ct values for PhHV-1 that are outside this expected
range are then repeated (Protocol 14.4). The benefit of this approach is that
it simultaneously controls for both the presence of PCR inhibitors as well as
inefficiencies in the extraction protocol. Further, the extraction of the seal
herpesvirus is more likely to mimic the extraction of the target virus of
interest, than, for instance, the use of a plasmid as an internal control. This
procedure is suitable for both quantitative and qualitative viral PCR appli-
cations and can also be used for quality control of new reagents or test
procedures. Almost any unrelated virus may be used in a similar manner, so
long as the virus is unlikely to be found in clinical samples, does not cross-
react with any of the primers and probes used in the clinical assays, and
preferably is not harmful to humans. The disadvantages of using such a
strategy are the increased costs and extra processing time of running the
internal control assay in addition to the test assay. Nonetheless, with
increasing regulation and accreditation of in-vitro diagnostic devices such
protocols should be considered as best practice.
14.4.2 Impact of target sequence variation on qPCR
Again, sequence variation may also have a significant impact upon the
accuracy of viral qPCR assays. Recently, we examined the impact of
sequence mismatches in the primer target sites on qPCR by constructing a
number of primers incorporating various mismatches with a target
sequence on the BKV T-antigen gene. Essentially these primers were modifi-
cations of the primers used in the BKV-Tag-qPCR assay described previously
(see Protocol 14.3). The results showed that as few as two mismatches in the
3’ end of a single primer could introduce considerable error, underestimat-
ing viral load by up to 3 logs (Whiley and Sloots, 2005b). The overall impact
this has on qPCR results is dependent on the conditions used in the assay
and may hinge on the nucleotide composition of the primers, the PCR
annealing temperature, the reaction mix composition and the specific
nucleotides that are the subject of mismatch.
The concern of sequence variation and its impact on qPCR led us to
examine a second BKV qPCR assay (BK-qLC) previously developed in our
laboratory. This assay was based on the original polyomavirus hybridization
probe assay, described above, using consensus primers and probes to detect
both human polyomaviruses, JCV and BKV, followed by melting curve
differentiation (Whiley et al., 2001). To make the assay specific for BKV, the
consensus forward primer (PoL1s; Whiley et al., 2001) was replaced with a
BKV specific forward primer. This new assay methodology (BK-qLC assay)
was then validated against the BKV-Tag-qPCR assay (see Protocol 14.3) for
Clinical virology 241
the detection of BKV in urine samples obtained from transplant patients.
The results showed good agreement between the two assays, with the detec-
tion of 19 BKV positive samples by both methods. In addition, there was
good agreement between the Ct values and estimated viral loads for all but
one of these 19 positive specimens. For 18 of these the average difference in
Ct values between the two assays was only 1.0 cycles and differences in viral
load were within one log. However, one positive specimen gave a Ct value
of 30.5 in the BK-qLC and 20.7 in the BKV-Tag-qPCR assay. This difference
of 9.8 cycles represented a difference in viral load of three logs and therefore
was a significant discrepancy between the two assays. Sequencing the PCR
product obtained in the BK-qLC from this specimen revealed a single base
mismatch of the nucleotide targeted by the extreme 3’ end of the forward
primer (see Troubleshooting guide 14.4).
Overall, these results show that sequence variation in the primer binding
sites can be the source of significant error in the estimation of viral load
using qPCR even when other sources of error are standardized. This has
considerable implications for viral quantification studies, particularly those
targeting viruses that exhibit extensive sequence variation between strains
and subtypes, such as the RNA viruses. Human metapneumovirus, respira-
tory syncytial virus and adenoviruses are just a few examples where
sequence heterogeneity has been demonstrated. In fact, by performing real-
time PCR assays targeting different genes in parallel for each of these
viruses, we have found significant discrepancies between Ct values for
positive specimens (data not published), suggesting that the impact of
sequence variation on qPCR may be significant.
Overall, these results show that the impact of sequence variation is quanti-
tative as well as qualitative. Interestingly, the BK-qLC performed well as a
qualitative assay in the initial evaluation, demonstrating that a good qualita-
tive PCR assay may not necessarily be suitable for use as a quantitative assay.
Clearly, a different procedure must be followed to validate a quantitative
assay to that employed for a qualitative assay. Such validation may involve
sequencing the primer and probe target sites and determining if mismatches
occur. Nevertheless, before accepting a viral qPCR protocol, we recommend
performing two separate assays in parallel, validating one against the other,
and comparing the Ct values to identify any discrepancies in performance.
Not withstanding the above issues, we have found the BKV-Tag-qPCR assay to
be reliable for quantifying BKV DNA and to date, have not found sequence
variation in the primer or probe target sites of any local BKV strains.
14.4.3 Additional comments
There are many other factors concerning viral qPCR standards that should
be considered. First, the use of plasmids as external standards has been criti-
cized, because, although these may be well characterized, little may be
known about the composition of the clinical samples being analyzed. Thus,
the use of plasmids may erroneously assume comparable amplification
characteristics to the viral target in test samples. Niesters and Puchhammer-
Stockl (2004) emphasize that standards should use whole virus diluted in
the same appropriate matrix as the clinical sample, and nucleic acids must
be isolated using the same extraction procedure. Multiple replicates of the
242 Real-time PCR
standards should be analyzed to determine confidence limits based on
inter-assay and intra-assay variation. The problems concerning standards
are further complicated by a lack of universally accepted international
standards for most clinically significant viruses (Niesters and Puchhammer-
Stockl, 2004), and thus, qPCR results may vary between different laborato-
ries. It is essential therefore, that clinicians are aware of these limitations
and their potential for variation in the qPCR results. Recognition of these
does not devalue the overall utility of qPCR, but rather will allow for a
proper assessment of the results within a relevant clinical context.
14.5 Conclusions
Real-time PCR methodologies for the detection of viruses are now firmly
entranced in many clinical laboratories, offering the major advantage of
improved sensitivity over more traditional methods. The application of this
technology has been most successful in those areas where conventional
virological techniques did not exist or were inadequate. Its introduction
into the virology laboratory has led to the recognition and improved
diagnostics of several viruses that may not be isolated, allowed for quantifi-
cation of viral loads during the infection process and the subsequent
monitoring of antiviral drug therapy, as well as characterization of
mutations in viral genes that are responsible for drug resistance.
The number of commercially available assays is increasing, but many labora-
tories still design, develop and validate assays in house. As these in-house, real-
time PCR methods have evolved there has been an increasing awareness of the
need for standardized reagents and quality control programs in order to
produce clinically significant results. In addition, the targeted nature of PCR
brings with it some inherent limitations that are difficult to control, particu-
larly in virology, where the heterogeneous nature of the viral genome may lead
to difficulties in assay design and performance. An awareness of these issues
will ultimately result in a better understanding of this new technology, and
enable us to fully explore its potential as a modern diagnostic tool.
References
Anderson TP, Werno AM, Beynon KA, Murdoch DR (2003) Failure to genotype
herpes simplex virus by real-time PCR assay and melting curve analysis due to
sequence variation within probe binding sites. J Clin Microbiol 41: 2135–2137.
Berger A, Braner J, Doerr HW, Weber B (1998) Quantification of viral load: clinical
relevance for human immunodeficiency virus, hepatitis B virus and hepatitis C
virus infection. Intervirology 41: 24–34.
Boeckh M, Boivin G. (1998) Quantitation of cytomegalovirus: methodologic aspects
and clinical applications. Clin Microbiol Rev 11: 533–554.
Espy MJ, Uhl JR, Mitchell PS, Thorvilson JN, Svien KA, Wold AD, Smith TF (2000)
Diagnosis of herpes simplex virus infections in the clinical laboratory by
LightCycler™ PCR. J Clin Microbiol 38: 795–799.
Fouchier RA, Bestebroer TM, Herfst S, Van Der Kemp L, Rimmelzwaan GF, Osterhaus
AD (2000) Detection of influenza A viruses from different species by PCR amplifi-
cation of conserved sequences in the matrix gene. J Clin Microbiol 38: 4096–4101.
Hammel JM, Chiang WK (2005) Update on emerging infections: news from the
Centers for Disease Control and Prevention. Outbreaks of avian influenza A
Clinical virology 243
(H5N1) in Asia and interim recommendations for evaluation and reporting of
suspected cases – United States, 2004. Ann Emerg Med 45: 88–92.
Hirsch HH, Mohaupt M, Klimkait T (2001) Prospective monitoring of BK virus load
after discontinuing sirolimus treatment in a renal transplant patient with BK
virus nephropathy. J Infect Dis 184: 1494–1495.
Kumar R, Vandegraaff N, Mundy L, Burrell CJ, Li P (2002) Evaluation of PCR-based
methods for the quantitation of integrated HIV-1 DNA. J Virol Methods 105: 233–246.
Kutyavin IV, Afonina IA, Mills A, Gorn VV, Lukhtanov EA, Belousov ES, Singer MJ,
Walburger DK, Lokhov SG, Gall AA, Dempcy R, Reed MW, Meyer RB, Hedgpeth
J (2000) 3’-minor groove binder-DNA probes increase sequence specificity at
PCR extension temperatures. Nucleic Acids Res 28: 655–661.
Mackay IM, Jacob KC, Woolhouse D, Waller K, Syrmis MW, Whiley DM, Siebert DJ,
Nissen M, Sloots TP (2003) Molecular assays for detection of human metapneu-
movirus. J Clin Microbiol 41: 100–105.
Maertzdorf J, Wang CK, Brown JB, Quinto JD, Chu M, de Graaf M, van den Hoogen
BG, Spaete R, Osterhaus AD, Fouchier RA (2004) Real-time reverse transcriptase
PCR assay for detection of human metapneumoviruses from all known genetic
lineages. J Clin Microbiol 42: 981–986.
Niesters HG (2004) Molecular and diagnostic clinical virology in real time. Clin
Microbiol Infect 10: 5–11.
Niesters HG, Puchhammer-Stockl E (2004) Standardisation and controls, why can’t
we overcome the hurdles? J Clin Virol 31: 81–83.
O’Doherty U, Swiggard WJ, Jeyakumar D, McGain D, Malim MH (2002) A sensitive,
quantitative assay for human immunodeficiency virus type 1 integration. J Virol
76: 10942–10950.
Smith TF, Uhl JR, Espy MJ, Sloan LM, Vetter EA, Jones MF, Rosenblatt, JE, Cockerill
FR 3rd (2004) Development, implementation, and trend analysis of real-time
PCR tests for the clinical microbiology laboratory. Clin Micro News 26: 145–153.
van den Hoogen, BG, de Jong J, de Groot R, Fouchier RA, Osterhaus AD (2001) A
newly discovered human pneumovirus isolated from young children with respi-
ratory tract disease. Nat Med 7: 719–724.
van den Hoogen BG, Herfst S, Sprong L, Cane PA, Forleo-Neto E, de Swart RL,
Osterhaus AD, Fouchier RA (2004) Antigenic and genetic variability of human
metapneumoviruses. Emerg Infect Dis 10: 658–666.
van Elden LJ, Nijhuis M, Schipper P, Schuurman R, van Loon AM (2001)
Simultaneous detection of influenza viruses A and B using real-time quantitative
PCR. J Clin Microbiol 39: 196–200.
Watzinger F, Suda M, Preuner S, Baumgartinger R, Ebner K, Baskova L, Niesters HG,
Lawitschka A, Lion T (2004) Real-time quantitative PCR assays for detection and
monitoring of pathogenic human viruses in immunosuppressed pediatric
patients. J Clin Microbiol 42: 5189–5198.
Weidmann M, Meyer-Konig U, Hufert FT (2003) Rapid detection of herpes simplex virus
and varicella-zoster virus infections by real-time PCR. J Clin Microbiol 41: 1565–1568.
Whiley DM, Mackay IM, Sloots TP (2001) Detection and differentiation of human
polyomaviruses JC and BK by LightCycler™ PCR. J Clin Microbiol 39: 4357–4361.
Whiley DM, Mackay I, Syrmis MW, Witt MJ, Sloots TP (2004) Detection and differ-
entiation of herpes simplex virus types 1 and 2 by a duplex LightCycler™ PCR
that incorporates an internal control PCR reaction. J Clin Virol 30: 32–38.
Whiley DM, Sloots TP (2005a) Melting curve analysis using hybridization probes:
limitations in microbial molecular diagnostics. Pathology 37: 254–256.
Whiley DM, Sloots TP (2005b) Sequence variation in primer targets affects the
accuracy of viral quantitative PCR. J Clin Virol 34: 104–107.
Whiley DM, Sloots TP (2006) Sequence variation can affect the performance of minor
groove binder TaqMan probes in viral diagnostic assays. J Clin Virol 35: 81–83.
244 Real-time PCR
Protocol 14.1: Detection
of influenza A by a 5’
nuclease real-time RT-PCR
assay
Sample preparation
Nasopharyngeal aspirate specimens are placed in
1mL of sterile saline and vigorously mixed on a
Vortex. Nucleic acids are extracted from 0.2 mL of
this suspension using the Roche MagNAPure™
instrument (Roche Diagnostics, Australia) as per
manufacturer’s instructions.
Influenza A oligonucleotides (targeting the
influenza A matrix gene)
Forward CTTCTAACCGAGGTCGAAACGTAa
Reverse GGTGACAGGATTGGTCTTGTCTTTAa
Probe Fam-TCAGGCCCCCTCAAAGCCGAG-BHQ1a
Reaction mix (Qiagen One-Step RT-PCR Kit;
Qiagen, Australia)
Qiagen One-Step RT-PCR Enzyme mix: 1.0 μL
Qiagen One-Step RT-PCR Buffer (5x): 5.0 μL
Qiagen One-Step RT-PCR dNTP mix
(10 mM): 1.0 μL
Forward primer (10 μM): 2.0 μL
Reverse primer (10 μM): 2.0 μL
Probe (20 μM): 0.2 μL
RNase-free water: 8.8 μL
Specimen or control nucleic acid extract: 5.0 μL
Total: 25.0 μL
Cycling conditions (ABI Prism® 7500; Applied
Biosystems, USA)
RT step 1 cycle:
50°C 20 min
Activation/denaturation 1 cycle:
95°C 15 min
Cycling 45cycles:
95°C 15 sec
60°C 60 sec
acquisition
Clinical virology 245
Result interpretation: Specimens providing exponential amplification
curves are considered positive for influenza A
RNA.
a
These sequences matched the matrix protein
genes of a broad range on influenza A subtypes,
including H1N1 (Genbank accession number
AY619976), H1N2 (AY233392), H2N2 (M63531),
H3N2 (AY210264), H5N1 (AY646180), H5N3
(AY300973), H7N2 (AY241624), H7N3
(AY611525), H7N7 (AJ619676), H9N2
(AF523497).
246 Real-time PCR
Protocol 14.2: Detection
and differentiation of
herpes simplex virus
types 1 and 2 using a
hybridization probe
real-time PCR assay
Sample preparation
Swab specimens are placed in 1 mL of sterile
saline and vortexed. Nucleic acids are extracted
from 0.2 mL of each suspension using the Roche
MagNAPure™ instrument (Roche Diagnostics,
Australia).
HSV oligonucleotides (targeting the HSV DNA
polymerase gene; Espy et al., 2000).
Forward GCTCGAGTGCGAAAAAACGTTC
Reverse CGGGGCGCTCGGCTAAC
Probe 1 GTACATCGGCGTCATCTGCGGGGGC
AAG-fluorescein
Probe 2 LC-Red640–TGCTCATCAAGGGCGTG
GATCTGGTGC-Phosphate
Reaction mix (LightCycler® FastStart DNA Master
Hybridization Probes kit; Roche Diagnostics,
Australia)
Roche kit Master reagent (10 x) 2.0 μL
MgCl2 (25 mM) 2.4 μL
Forward primer (10 μM) 0.4 μL
Reverse primer (10 μM) 0.8 μL
Probe 1 (20 μM) 0.2 μL
Probe 1 (20 μM) 0.2 μL
RNase-free water 9.0 μL
Specimen or control nucleic acid extract 5.0 μL
Total 20.0 μL
Clinical virology 247
Cycling conditions (LightCycler®; Roche
Diagnostics, Australia)
Activation/denaturation 1 cycle:
95°C 10 min
Cycling 55 cycles:
95°C 10 sec
55°C 10 sec single acquisition
72°C 20 sec
Melting curve analysis 1 cycle:
95°C 5 sec
40°C 5 sec
95°C 5 sec continuous acquisition
(ramp at 0.2°C/sec)
Result interpretation: Specimens providing a melting temperature of
67°C are considered positive for HSV type 1 DNA
whereas specimens providing a melting tempera-
ture of 74°C are considered positive for HSV type
2 DNA.
248 Real-time PCR
Protocol 14.3:
Quantitative analysis of
BKV load by a 5’
nuclease real-time PCR
(BKV-Tag-qPCR) assay
Sample and standard preparation
Specimens and standards are prepared in the
same manner, and should also include internal
control nucleic acid (see Protocol 14.4). Standards
must be diluted in the appropriate matrix, for
example when urine samples are tested, 10-fold
dilutions of the standard are prepared in negative
urine. Briefly, 100 μL of BKV standard at 1 x 10 8
copies per mL is added to 900 μL of negative
urine. Subsequent dilutions are performed to
provide seven standards ranging from 1 x 107 to
10 copies per mL of urine. Nucleic acids are
extracted from 0.2 mL of each sample and
standards using the Roche MagNAPure™
instrument (Roche Diagnostics, Australia).
BKV oligonucleotides (targeting the BKV T antigen
gene; Hirsch et al., 2001)
Forward primer AGCAGGCAAGGGTTCTATTAC
TAAAT
Reverse primer GAAGCAACAGCAGATTCTCAACA
Probe FAM-AAGACCCTAAAGACTTTCC
CTCTGATCTACACCAGTTT-
TAMRA
Reaction mix (TaqMan® Universal PCR Master
Mix; Applied Biosystems, Australia)
TaqMan® Universal PCR Master Mix 12.5 μL
Forward primer (10 μM) 1.0 μL
Reverse primer (10 μM) 1.0 μL
Probe (20 μM) 0.2 μL
RNase-free water 5.3 μL
Specimen or control nucleic acid extract 5.0 μL
Total 25.0 μL
Clinical virology 249
Cycling conditions (ABI Prism® 7500; Applied
Biosystems, United States)
Activation/denaturation 1 cycle:
95°C 10 min
Cycling 5 cycles:
95°C 15 sec
60°C 60 sec acquisition
Result interpretation: The BKV concentration in each specimen is deter-
mined using a standard curve. Standard curves
are generated from the range of controls included
in the assay protocol, by software provided with
the instrument (ABI 7500 system V.1.2.3f2).
Values are expressed in copies per mL of speci-
men. Results are interpreted subject to the inter-
nal control results (see Protocol 14.4).
250 Real-time PCR
Protocol 14.4: Real-time
PCR internal control
(Niesters, 2004)
Sample preparation:
The concentration of seal herpesvirus (PhHV-1)
added to each patient specimen should be
sufficient to provide an average Ct value of
approximately cycle 30 in a correctly extracted
sample containing no PCR inhibitors. This equates
to a final concentration of approximately 5,000
copies per mL of specimen. Briefly, 10μL of
PhHV-1 at 500 copies per μL should be added to
1mL of each specimen.
PhHV-1 oligonucleotides
Forward primer GGGCGAATCACAGATTGAATC
Reverse primer GCGGTTCCAAACGTACCAA
Probe TTTTTATGTGTCCGCCACCAT
CTGGATC
The reaction mix, fluorophores and cycling
conditions used for the PhHV-1 assay can readily
be adapted to those utilized by the testing
laboratory. Conditions must be standardized so
that the assay achieves a Ct value of
approximately cycle 30, with minimal inter-assay
and intra-assay variability, for a correctly extracted
sample containing no PCR inhibitors.
Result interpretation: Specimens providing Ct values exceeding two
standard deviations from the expected Ct value
are considered to be unsuitable. They may
contain PCR inhibitors, have been inefficiently
extracted, or have been subject to other
conditions that have compromised the PCR. These
specimens should be repeated.
Specimens providing Ct values within two
standard deviations from the expected Ct value
can be used in the calculation of viral load of the
target test virus using a standard curve.
Clinical virology 251
Troubleshooting guide
14.1: False-negative
result in the
WhSl-para3–5N assay
The specimen that was not detected in the WhSl-
para3–5N assay was investigated further to
identify the cause of the assay failure. Following
thermocycling, the WhSl-para3–5N PCR reaction
mix for this specimen was examined by gel
electrophoresis and a PCR amplification product
of the expected size (105 base pairs) was
observed (see Figure 14.1). This demonstrates that
amplification had occurred and suggests that the
Figure 14.1
Gel electrophoresis image of the reaction mix from the specimen providing a
false-negative result in the WhSl-para3–5N assay. A 105 base pair product was
observed for the specimen (run in duplicate in lanes 6 and 7) and positive
controls (lanes 2 and 3) but not in the negative controls (lanes 4 and 5). A 200
base pair ladder was included in lane 1.
252 Real-time PCR
source of the failure was not in amplification but
in the detection of the amplification product. The
PCR product from this specimen was then
sequenced to identify the oligonucleotide target
sequences in this parainfluenza type 3 strain.
The fact that an amplification product was
produced indicated that both primers hybridized
to the target, therefore, mismatches between the
probe and its target appeared to be the likely
source of the problem. Thus, the same primers
that were used in the WhSl-para3–5N assay could
be used for the DNA sequencing reaction. On the
other hand, had a PCR product not been
obtained, then mismatches between the primers
and their targets would be the more probable
explanation. Thus, a second primer pair, external
to those utilized by the assay would need to be
designed and employed to sequence the primer
targets. Nevertheless, for this investigation a
second external primer was used to illustrate the
process.
Briefly, the two external primers (forward
ACCAGGAAACTATGCTGCAGAACGGC and
reverse CCATACCTGATTGTATTGAAGAATGAAGC)
were used in a standard RT-PCR reaction to
amplify a 409 base pair sequence from the above
specimen. The amplification products were
separated by electrophoresis through a 1%
agarose gel. The specific band (409 bp) was
excised and purified using a QIAquick gel
extraction kit (Qiagen, Germany). DNA
sequencing was performed using the above
forward primer in an ABI Prism Dye Terminator
Cycle Sequencing kit (Applied Biosystems, USA)
and was analyzed on an ABI 377 DNA sequencer
(Applied Biosystems, USA). The sequence
obtained from this specimen was then compared
to the primer and probe sequences used in the
WhSl-para3–5N assay.
Interestingly, the sequencing results showed that
mismatches (bold underlined) were present with
all three oligonucleotides. For both primers, there
were mismatches towards the 5’ end. It should be
noted that the length and Tm of primers typically
used in standard TaqMan® cycling conditions will
usually allow them to accommodate one or two
5’ mismatches with little impact on the PCR. This
is consistent with the results observed here, where
Clinical virology 253
amplification product was present for this
specimen. However, in this parainfluenza type 3
strain there were four mismatches within the
binding site of the WhSl-para3–5N TaqMan™
probe. This many mismatches most likely
prevented the probe from adequately hybridizing
to the target and therefore caused the detection
failure.
F Primer CGGTGACACAGTGGATCAGATT
Specimen TGGTGACACAGTGGATCAGATT
R Primer AGGTCATTTCTGCTAGTATTCATTGT
TATT
Specimen AGATCATTCCTGCTAGTATTCATTGT
TATT
Probe TCAATCATGCGGTCTCAACAGAGC
TTG
Specimen TCAATTATGCGATCCCAACAGAGC
TTA
254 Real-time PCR
Troubleshooting guide
14.2: Variation in
fluorescent signal from
positive specimens in the
RSV MGB assay
Three RSV-positive specimens providing
representative fluorescent signals (see Figure 14.2)
were investigated further to identify the cause of
the variation in fluorescent response. Briefly, the
PCR products from these specimens were
Specimen 1
0.10
0.08
Specimen 2
0.06
Delta Rn
0.04
Specimen 3
0.02
0 Negative control
0 5 10 15 20 25 30 35 40
Cycle number
Figure 14.2
Fluorescent signal for three representative positive specimens in the RSV MGB
probe assay.
Clinical virology 255
sequenced and probe targets compared to the
RSV MGB TaqMan® probe sequence. For this
investigation, the same primers used in the
respiratory syncytial virus assay were used to
sequence the forward and reverse DNA strains of
the PCR products.
The sequencing results showed that specimen 1,
which provided optimal fluorescence, had no
mismatches with the RSV MGB probe. In contrast,
specimens 2 and 3, which provided lower
fluorescent signal, each had a single mismatch
(bold underlined) with the probe. The
mismatched bases in each of these specimens
were at different positions on the probe and
resulted in varying fluorescent signals.
RSV MGB probe TCAATACCAGCTTATAGAAC
Specimen 1 TCAATACCAGCTTATAGAAC
Specimen 2 TCTATACCAGCTTATAGAAC
Specimen 3 TCAATACCAGCTTACAGAAC
0.08 HSV type 2 HSV type 2 HSV type 2
0.07 specimen A specimen B positive control
Fluorescence –d(F2/F1)/dT
0.06
0.05
0.04
0.03
0.02
0.01
0.00
–0.01
–0.02
–0.03
–0.04
44.0 46.0 48.0 50.0 52.0 54.0 56.0 58.0 60.0 62.0 64.0 66.0 68.0 70.0 72.0 74.0 76.0 78.0 80.0 82.0 84.0 86.0 88.0 90.0 92.0
Temperature (°C)
Figure 14.3
LightCycler® melting curve analysis for two herpes simplex virus type 2 positive
specimens showing uncharacteristic melting temperatures compared to a herpes
simplex virus type 2 positive control. The results were obtained using a
hybridization probe-based assay targeting the DNA polymerase gene.
256 Real-time PCR
Troubleshooting guide
14.3: Uncharacteristic
herpes simplex virus
type 2 melting curves
Two herpes simplex virus (HSV) type 2 positive
specimens providing uncharacteristic melting
curves were further investigated to identify the
cause of the shift in melting temperature. Briefly,
PCR products from these specimens were
sequenced and the probe target sequence was
compared to the Espy hybridization probe
sequences, which should be fully complementary
to HSV type 2 DNA. For this investigation, it was
unnecessary to design primers outside the Espy
primer targets, as the probe target sequences
were of primary interest. Thus, the primers utilized
in the Espy HSV assay (Protocol 16.2) were used to
sequence the PCR products in forward and reverse
direction.
The sequencing results showed that both of the HSV type 2 positive specimens
had mismatches with the Espy hybridization probes. For specimen A there
were three mismatches (bold-underlined) compared to the Espy probe 2
sequence and for specimen B there were two mismatches (bold-underlined)
compared to the Espy probe 1 sequence.
Probe 1 GTACATCGGCGTCATCTGCGGGGGCAAG
Strain A GTACATCGGCGTCATCTGCGGGGGCAAG
Strain B GTACATCGGCGTTATTTGCGGGGGCAAG
Probe 2 TGCTCATCAAGGGCGTGGATCTGGTGC
Strain A TGCTCATTAAGGGCGTCGACCTGGTGC
Strain B TGCTCATCAAGGGCGTGGATCTGGTGC
Clinical virology 257
Troubleshooting guide
14.4: Underestimation of
BK viral load due to
sequence variation
The specimen providing discrepant BKV viral load
results between the BK-qLC and BKV-Tag-qPCR
assays was further investigated. Briefly, the DNA
segment of the VP2 gene targeted by the BK-qLC
PCR assay was sequenced using primers external
to those used in the assay. The sequence was then
compared to the primer and probe sequences
used in the BK-qLC assay.
The results showed a single base mismatch (bold-
underlined) with the forward primer was responsi-
ble for the change in amplification characteristics
in the BK-qLC assay. It should be noted that the
annealing temperature used in the BK-qLC assay
was 55°C whereas the Tm of this primer (calcu-
lated using Primer Premier version 5; Premier
Biosoft International, CA, USA) was only 51.8°C
assuming no mismatches and 47.6°C if the 3’
cytosine base was excluded. Thus, the low Tm of
this primer was likely to have compounded the
effects of sequence mismatch.
Forward primer GTAAAAGACTCTGTAAAAGACTCC
Specimen GTAAAAGACTCTGTAAAAGACTCG
Solid organ transplant
monitoring
Omaima M. Sabek
15
15.1 Introduction
Over the past several decades, many factors have led to higher rates of
patient and graft survival in organ transplantation. These include enhanced
immunosuppression, infectious disease prophylaxis, advances in surgical
technique, better patient selection criteria, optimal timing of transplanta-
tion, and better options for treating complications (Hariharan et al., 2000;
Adam and Del Gaudio, 2003). As a result of these advanced immunosup-
pressive treatments, graft loss due to acute rejection is now rare among
solid-organ transplants. The optimal strategy for immunosuppressive treat-
ment in the future will tailor low-dose immunosuppression to the patient’s
needs with avoidance (or early withdrawal) of corticosteroid and lower
doses of calcineurin inhibitors. Drugs aimed at tolerance induction and
inhibition of adhesion molecule expression might also lead to better
outcomes for many recipients in the near future (Ortiz et al., 2003; Heeger,
2003). However, these substantial gains have not prevented graft loss so
much as they have delayed it. To improve transplant outcomes, we need a
better understanding of predisposing immunologic and non-immunologic
factors. With more sensitive analytical methods, it is becoming increasingly
clear that efforts to prevent chronic rejection and avoid inappropriate
immunosuppression must include and effective means to proximally
diagnose acute cellular rejection (ACR), including sub-clinical forms of
injury. The role of concomitant viral infection is also being recognized as
increasing germane, and these methods may also assist in more precisely
identifying the origin and the ‘intent’ of immune cell infiltrates. Molecular
techniques have become a mainstay for most biomedical research. In partic-
ular, sensitive methods for gene transcript detection have played an impor-
tant role in our understanding of the basic mechanisms promoting
allosensitization and adaptive immune regulation. It is becoming increas-
ingly clear that these techniques will aid to better understand human trans-
plant biology, and, more importantly, guide clinical decision making with
mechanistically based information. By allowing for critical analysis of the
blood and graft microenvironment, these assays are providing early mecha-
nistic data aiding in the correlation of basic and clinical scientific concepts.
This chapter will discuss the use of real-time polymerase chain reaction in
gene transcript quantification, gene polymorphism analysis, viral load
detection and quantification. Clinical correlations will be presented as
examples of how these techniques may have clinical relevance.
260 Real-time PCR
15.2 Real-time quantitative PCR
Real-time quantitative PCR allows for a rapid and precise relative quantifi-
cation of gene transcripts. Real-time PCR has been shown to exceed the
sensitivity of northern blots and RNase protection assays and allows for
quantitative study of multiple transcripts with high reproducibility which is
a major strength of this method. The reproducibility of the results obtained
by real-time PCR is another. Moreover, because the chemistry used is
standard and the primers and probes are designed to be compatible, there is
consistency. The advantage for using the real-time PCR in a clinical setting,
however, is the speed by which the test can be performed. The turnaround
time for the assay from time of sample collection is approximately 4 to 6
hour. This is important clinically because surveillance testing of transplant
patients using this methodology can be performed without alteration in
clinic or hospital procedure and within the already established clinical
pathways for posttransplant care.
15.3 RNA normalization
With the increased interest in gene marker based diagnosis, the choice of
housekeeping genes for the various assays becomes an important consider-
ation that could affect sensitivity, specificity, and across laboratory repro-
ducibility of results. In our Laboratory, we performed a detailed
examination of 11 available housekeeping genes in peripheral blood of
healthy volunteers before selecting a suitable housekeeping gene for our
assay (Sabek et al., 2002). Expression of the following housekeeping genes
was evaluated: 18S rRNA (18S), acidic ribosomal protein (PO), beta-actin
(βA), cyclophilin (CYC), glyceraldehyde-3–phosphate dehydrogenase
(GAPDH), phosphoglycerokinase (PGK), β2-microglobulin (β2m), β-
glucuronidase (GUS), hypoxanthine phosphoribosyl transferase (HPRT),
transcription factor IID, TATA-binding protein (TBP), transferring receptor
(TfR). The results of indicated that 18S, β-actin, and β-glucuronidase have
the least variability of expression over time and are more reliable for
normalizing our data. Surprisingly, other housekeeping genes used in
previous human studies, such as GAPDH and cyclophilin, had higher
variability between specimens and generated irreproducible results. The
lack of reliability of GAPDH as a housekeeping gene has been observed by
others as well (Tricarico et al., 2002; Bustin, 2000). Hoffmann et al. (2003)
has shown that 18s RNA was an appropriate candidate housekeeping
control for transcript normalization since its expression levels were not
found to vary among different tissues, cell types, with or without stimula-
tion, or from experimental treatments. In contrast GAPDH and β-actin
expression varied widely, exhibiting Ct fluctuations and nearly 10-fold
differences in some activated cell populations. In addition, cyclophilin is
not a practical calibrator for transplantation-related studies due to its direct
role in the calcineurin pathway affected by standard immunosuppressive
therapies. GUS was found to be a fairly constant and reliable expression
target. However, the level of GUS transcript expression may compete with
several immune targets and, therefore, does not allow for multiplex assays
and could invalidate quantitative precision. Based on these findings 18s
Solid organ transplant monitoring 261
RNA was regarded as the most reliable internal housekeeping control for
analyses. However, it is vital to test for the effect of different drugs used on
the expression levels of the housekeeping genes if we are to incorporate this
technique as standard clinical tool for monitoring allograft dysfunction and
guiding individualized immunotherapeutic interventions. Further discus-
sion of the choice of a normalizer gene is presented in Chapter 4.
15.4 Immunologic monitoring in solid organ
transplantation
Improvement of patient and graft survival rates and the post transplantation
quality of life depends on many pre- and post-transplant factors, such as
tissue compatibility, immunosuppressive therapy, as well as the early detec-
tion and treatment of both acute and chronic graft rejection. Allograft
antigens presented to the host immune system in association with the major
histocompatibility complex (MHC)-encoded molecules initiate lymphocyte
activation and proliferation of the primed lymphocytes leading to both cellu-
lar and/or humoral rejection. The cytokines are essential for the differentia-
tion, proliferation, and amplification of the T-cell responses (Schwartz, 1992).
The most important one is interleukin-2 (IL-2), which is essential for activated
T-cell proliferation. Monitoring intragraft cytokines such as IL-2, IL-4, IL-10
and interferon-γ using real-time PCR (Flohe et al., 1998; Hahn et al., 2001),
although invasive, is simple and has been shown to be effective in character-
izing and predicting graft rejection and tolerance. Koop et al, (2004) showed
that differentiation between chronic rejection and chronic cyclosporine
toxicity in renal transplant patients may be more reliably detected using the
molecular technique of a real-time PCR quantitative analysis of the renal
cortical mRNA levels of laminin β2 and extracellular matrix regulation
molecule transforming growth factor-β. Using a less invasive technique to
monitor intracellular T-cell cytokines such as (Il-2, IL-4,IL-10, TNF, RANTES,
and IFNγ) levels in lymphocyte subsets (CD3/CD4 and CD3/CD8) as well as
activation markers CD25 (IL-2R), CD40 CD69, CD71, CD103 and cytotoxic
effector molecules such as perforin, granzyme B and FasL in peripheral blood
and urine cytokines was shown to be predictive (Li et al., 2001; Ding et al.,
2003; Muthukumar et al., 2003; Dadhania et al., 2003; Tatapudi et al., 2004;
Shoker et al., 2000; Satterwhite et al., 2003; Sabek et al., 2002). Simon et al.
(2003) reported that renal rejection diagnosis using perforin and granzyme B
gene expression measurements was possible 2–30 days before traditional
clinical diagnosis (i.e. elevation of serum creatinine) and that gene expression
measurement is a useful tool for the recognition of graft rejection in its earli-
est stages. Findings from these studies suggest that serial measurements could
be implemented as a monitoring system to highlight patients at higher risk of
rejection, making them candidates for biopsy or pre-emptive anti-rejection
therapy. Such early intervention may be more effective than therapy initiated
after organ damage has already occurred.
15.5 Pharmacogenetics in solid organ transplantation
Many pharmacogenomic predictors of drug response are now available, and
include both drug metabolism-disposition factors and drug targets. It is well
262 Real-time PCR
recognized that different transplant recipients respond in different ways to
immunosuppressive medication (Zheng et al., 2005). The inter-individual
variations are greater than the intra-individual variations, a finding consis-
tent with the notion that inheritance is a determinant of drug responses. In
the general population, it is estimated that genetics accounts for 20 to 95%
of the variability in drug disposition and effects (Kalow et al., 1998). Many
other non-genetic factors, such as organ function, drug interactions, and
the nature of the disease, probably influence the effects of medication. The
recent identification of genetic polymorphisms in drug-metabolizing
enzymes and drug transporters led to the hypothesis that genetic factors
may be implicated in the inter-individual variability of the pharmacoki-
netic or pharmacodynamic characteristics of immunosuppressive drugs,
major side effects, and immunologic risks. The promising role of pharma-
cogenetics and pharmacogenomics in the effort to elucidate the inherited
basis of differences between individual responses to drugs, lies in the poten-
tial ability to identify the right drug and dose for each patient. As an
example, Mycophenolate mofetil (MMF) is an immunosuppressant widely
used for the prophylaxis of organ rejection in renal, pancreas, and liver
transplantation (Cai et al., 1998; Detry et al., 2003). It inhibits the inducible
isoform of the enzyme inosine-monophosphate dehydrogenase (IMPDH II).
IMPDH II is necessary for de novo purine synthesis in activated lymphocytes,
whereas other cells generate purine nucleotides via the salvage pathway
(Allison and Eugui, 2000). The use of MMF in liver transplantation (Detry et
al., 2003), can be used to reduce the dosage of calcineurin inhibitors and
steroids (Moreno et al., 2003). However, MMF administration may be associ-
ated with bone marrow and gastrointestinal toxicity, thus requiring thera-
peutic drug monitoring. The quantitation of gene transcription of the
IMPDH inducible isoform using quantitative real-time PCR is feasible and
reliable and may represent an important alternative to enzyme activity
measurements based on liquid chromatographic methods. Therefore, the
capability to discriminate between increased expressions of the inducible
versus the constitutive isoform appears to be of critical importance.
Moreover, a quantitative PCR assay may be used to analyze the drug target,
thus reflecting MMF efficacy and tolerability, allowing a personalized
immunosuppressive therapy.
15.6 Cytokine gene polymorphism analysis
While a wide range of factors contributes to allograft survivability, routine
screening of cytokine gene polymorphisms may have important clinical
relevance and therefore should be considered in the design of both pre- and
post-treatment regimens. Most cytokines have been demonstrated to be
transcriptionally controlled. Cytokines influence the local activation of
cells and play a critical role in the regulation of immune responses. While
functional affects have been attributed to cytokine gene variants
(Hoffmann et al., 2001; Louis et al., 1998; Turner et al., 1997), their role in
allograft rejection remains controversial. The level of production of many of
these cytokines may be important in accelerating or slowing the rejection
process. The inheritance of genetically determined polymorphisms has
been implicated in the development of both acute and chronic renal
Solid organ transplant monitoring 263
allograft rejection (Hutchinson, 1999; Hutchinson et al., 2000) and periph-
eral tolerance (Burlingham et al., 2000). Indeed, some studies have shown
allelic variations within cytokine genes might act on the microenvironment
of responding T cells and APCs, and thereby regulate allograft survival. A
more clear definition of cytokine genotypes may indicate how recipients
will respond to their transplants and guide both optimal immunotherapy,
organ selection, or enable selection of patient subgroups for individualized
clinical trials (Hoffmann et al., 2001, Sankaran et al., 1999).
15.6.1 Recipient and donor gene polymorphisms
In a recent study by Hoffmann et al. (2003) where they compared patient
and donor allelic genotypes in renal transplant patients and established
phenotypes to allograft status as defined by Banff criteria in serial protocol
biopsies (Racusen et al., 1999). They showed that high production alleles for
either IL-10 or IFN-gamma were dominant in recipients with Banff criteria
for chronic changes compared to a control group. They also showed that in
the rejections patients that were resistant to initial steroid therapy alone,
those individuals were of the high IFN-gamma producer phenotype. Not
only recipient but donor related factors, in particular the age and ethnicity
of the donor can play a role in an early rejection episode (Marshall et al.,
2001; Swanson et al., 2002; Verran et al., 2001). Donor brain death and
allograft ischemia are a traumatic process that can affect cytokine produc-
tion (Pratschke et al., 2000). The impact of high donor IFN-gamma and IL-
10 production was shown to be significant (Hoffmann et al., 2003) on
recipients presenting with sub-clinical rejection, ACR or chronic changes
when compared to those donors with stable recipients and normal allograft
histology. These results suggest that donor-derived production may play an
essential role in inflammatory processes initiating rejection. Given the
shortage of suitable donor organs, the acceptance of organs from marginal
donors is rising, warranting an assessment of donor specific variables
(Gjertson et al., 2002; Randhawa, 2001).
15.6.2 Ethnicity and cytokine gene polymorphism
Ethnicity clearly is associated with dramatic differences in cytokine
polymorphism distributions. The disparity between graft survival rates
among African–American and other populations suggests that the cytokine
polymorphisms described by many laboratories, including our own (Lo et
al., 2004; Egidi and Gaber, 2003; Hartwig et al., 1993; Hardinger et al., 2001;
Lo et al., 2001; Ilyas et al., 1998), may play an incremental role in ethnic-
based survival rates and subsequent differences in immune reactivity.
Indeed, there is a documented deficit in long-term allograft survival for
African–Americans as compared to Caucasian, Hispanic, and Asian popula-
tions (USRDS, 2000). Poor graft survival among African–Americans had
been attributed in part to socioeconomic factors and to inferior HLA match-
ing. African–American donor kidneys also have been associated with a
worse graft survival (Yates et al., 2003). Studies examining potential effects
of polymorphisms on pharmacokinetics and immune responsiveness have
also been performed showing that peripheral blood cells from healthy adult
264 Real-time PCR
African–Americans express significantly more B7 costimulatory molecules
(CD80, CD86) than Caucasians and mount more vigorous immune
responses to mitogens and antigens in vitro (Hutchings et al., 1999;
Lindholm et al., 1992; Tornatore et al., 1995). Factors such as these could
represent additional key factors for racial variation in allograft loss (Cox et
al., 2001; Kerman et al., 1991; Gaston et al., 1992). There are striking differ-
ences in the distribution of cytokine polymorphisms among ethnic popula-
tions (Hoffmann et al., 2002; Cox et al., 2001). Blacks, Hispanics and Asians
have marked differences in their inheritance of IL-6 alleles and IL-10
genotypes that result in high expression when compared with Caucasian.
High IL-6 producing individuals have previously been shown to be at
heightened risk for ACR and/or some forms of end-stage renal disease
(Casiraghi et al., 1997; Hoffmann et al., 2003). The high production of IL-6
in concert with pro-inflammatory cytokines, may result in an increase risk
for allograft rejection in the African–American population, or at least
increase the impact of alterations in immunosuppressive non-compliance.
While, Asians exhibit IFN-gamma genotypes that result in diminished
cytotoxic effects thereby a decrease risk of acute graft rejections. This obser-
vation suggests that a population of recipients more prone to ACR may be
predicted through study of cytokine gene polymorphisms.
15.7 Viral infection in transplant patients
Viral pathogens have emerged as the most important microbial agents
having deleterious effects on solid organ transplant recipients. Antiviral
chemoprophylaxis involves the administration of medications to abort
transmission of, avoid reactivation of, or prevent progression to disease
from, active viral infection. Real-time PCR amplification techniques are
currently used to determine the viral load in clinical samples for an increas-
ing number of targets, and in a short turn-around time, and to determine
whether variants relevant for antiviral resistance are present (see, for
example, Chapter 14). Technological improvements, from automated
sample isolation to real-time amplification technology, have given the
ability to develop and introduce systems for most viruses of clinical interest,
and to obtain clinical relevant information needed for optimal antiviral
treatment options. Treatment initiation is based not only on the viral load
itself but also on a combination of difference criteria, including the kinetics
of the viral load and the patient’s immune condition. Cytomegalovirus
(CMV) is the major microbial pathogen having a negative effect on solid
organ transplant recipients. CMV causes infectious disease syndromes, and
is commonly associated with opportunistic super infection. CMV has also
been implicated in the pathogenesis of rejection. The ability to detect
persistent low-level CMV replication after termination of antiviral therapy
as well as the viral load at the completion of antiviral therapy is also of
interest and may lead to treatment adjustment and prevent the risk of
emergence of resistant strains (Boivin et al., 2001). The viral load at the
completion of antiviral therapy has been shown to predict the risk of relaps-
ing (Sia et al., 2000). But, most importantly, a negative result from a reliable
sensitive assay can rule out CMV replication and may prevent unnecessary
treatment. Herpes simplex virus (HSV) reactivation in solid organ trans-
Solid organ transplant monitoring 265
plant recipients is invasive, more frequent, takes longer to heal, and has
greater potential for dissemination to visceral organs than it does in the
immunocompetent host. Epstein–Barr virus (EBV) has its most significant
effect in solid organ transplant as the precipitating factor in the develop-
ment of post-transplant lymphoproliferative disorders (PTLD) as well as
rejection (Jabs et al., 2004). Over the past few years, PCR assay has shown
that a rapid increase in peripheral blood EBV DNA load is predictive of
PTLD (Qu et al., 2000). Identifying patients at high risk or in an early stage
of PTLD enables EBV infection to be pre-emptively or promptly dealt with
by administering anti-CD20 monoclonal antibody or EBV-CTL, or simply
by reducing the immunosuppressive therapy (Wagner et al., 2004; Kuehnle
et al., 2000). In conclusion, EBV reactivation, increase in viral-load detec-
tion by quantitative real-time PCR, can be managed simply by modulating
immunosuppression. Hepatitis B virus (HBV) and hepatitis C virus (HCV)
are important pathogens in the solid organ transplant population as indica-
tions for transplantation. Prophylaxis for recurrent HBV and HCV after liver
transplantation is controversial, suppressive rather than preventive, and
potentially lifelong. Influenza infection after solid organ transplant is
acquired by person-to-person contact. During epidemic periods of
influenza, transplant populations experience a relatively high frequency of
infection, and influenza may affect immunosuppressed solid organ trans-
plant recipients more adversely than immunocompetent individuals. As we
carry all of the above knowledge to the clinic, immunologic monitoring
should start prior to transplantation and should continue for as long as
immunosuppressive therapy is needed.
References
Adam R, Del Gaudio M (2003) Evolution of liver transplantation for hepatocellular
carcinoma. J Hepatol 39(6): 888–895.
Allison AC, Eugui EM (2000) Mycophenolate mofetil and its mechanisms of action.
Immunopharmacology 47(2–3): 85–118.
Boivin G, Gilbert C, Gaudreau A, Greenfield I, Sudlow R, Roberts NA (2001) Rate of
emergence of cytomegalovirus (CMV) mutations in leukocytes of patients with
acquired immunodeficiency syndrome who are receiving valganciclovir as
induction and maintenance therapy for CMV retinitis. J Infect Dis 184(12):
1598–1602.
Burlingham WJ, O’Connell PJ, Jacobson LM, Becker BN, Kirk AD, Pravica V,
Hutchinson IV (2000) Tumor necrosis factor-alpha and tumor growth factor-
beta1 genotype: partial association with intragraft gene expression in two cases
of long-term peripheral tolerance to a kidney transplant. Transplantation 69(7):
1527–1530.
Bustin SA (2000) Absolute quantification of mRNA using real-time reverse transcrip-
tion polymerase chain reaction assays. J Mol Endocrinol 25(2): 169–193.
Cai TH, Esterl RM, Jr, Nichols L, Cigarroa F, Speeg KV, Halff, GA (1998) Improved
immunosuppression with combination tacrolimus (FK506) and mycophenolic
acid in orthotopic liver transplantation. Transplant Proc 30(4): 1413–1414.
Casiraghi F, Ruggenenti P, Noris M, Locatelli G, Perico N, Perna A, Remuzzi G (1997)
Sequential monitoring of urine-soluble interleukin 2 receptor and interleukin 6
predicts acute rejection of human renal allografts before clinical or laboratory
signs of renal dysfunction. Transplantation 63(10): 1508–1514.
Cox ED, Hoffmann SC, DiMercurio BS, Wesley RA, Harlan DM, Kirk AD, Blair PJ
266 Real-time PCR
(2001) Cytokine polymorphic analyses indicate ethnic differences in the allelic
distribution of interleukin-2 and interleukin-6. Transplantation 72(4): 720–726.
Dadhania D, Muthukumar T, Ding R, Li B, Hartono C, Serur D, Seshan SV, Sharma
VK, Kapur S, Suthanthiran M (2003) Molecular signatures of urinary cells distin-
guish acute rejection of renal allografts from urinary tract infection
Transplantation 75(10): 1752–1754.
Detry O, de Roover A, Delwaide J, Meurisse M, Honore P (2003) The use of mycophe-
nolate mofetil in liver transplant recipients. Expert Opin Pharmacother 4(11):
1949–1957.
Ding R, Li B, Muthukumar T, Dadhania D, Medeiros M, Hartono C, Serur D, Seshan
SV, Sharma VK, Kapur S, Suthanthiran M (2003) CD103 mRNA levels in urinary
cells predict acute rejection of renal allografts. Transplantation 75(8): 1307–1312.
Egidi MF, Gaber AO (2003) Outcomes of African–American kidney-transplant reci-
pients treated with sirolimus, tacrolimus, and corticosteroids. Transplantation
75(4): 572; author reply 573.
Flohe S, Speidel N, Flach R, Lange R, Erhard J, Schade FU (1998) Expression of HSP 70
as a potential prognostic marker for acute rejection in human liver transplanta-
tion Transpl Int 11(2): 89–94.
Gaston RS, Hudson SL, Deierhoi MH, Barber WH, Laskow DA, Julian BA, Curtis JJ,
Barger BO, Shroyer TW, Diethelm AG (1992). Improved survival of primary
cadaveric renal allografts in blacks with quadruple immunosuppression.
Transplantation 53(1): 103–109.
Gjertson DW, Dabrowska DM, Cui X, Cecka JM (2002) Four causes of cadaveric
kidney transplant failure: a competing risk analysis. Am J Transplant 2(1):
84–93.
Hahn AB, Kasten-Jolly JC, Constantino DM, Graffunder E, Singh TP, Shen GK, Conti
DJ (2001) TNF-alpha, IL-6, IFN-gamma, and IL-10 gene expression polymor-
phisms and the IL-4 receptor alpha-chain variant Q576R: effects on renal
allograft outcome. Transplantation 72(4): 660–665.
Hardinger KL, Stratta RJ, Egidi MF, Alloway RR, Shokouh-Amiri MH, Gaber LW,
Grewal HP, Honaker MR, Vera S, Gaber AO (2001) Renal allograft outcomes in
African American versus Caucasian transplant recipients in the tacrolimus era.
Surgery 130(4): 738–745.
Hariharan S, Johnson CP, Bresnahan BA, Taranto SE, McIntosh MJ, Stablein D (2000)
Improved graft survival after renal transplantation in the United States, 1988 to
1996. N Engl J Med 342(9): 605–612.
Hartwig MS, Hall G, Hathaway D, Gaber AO (1993) Effect of organ donor race on
health team procurement efforts. Arch Surg 128(2): 1331–1335.
Heeger PS (2003) What’s new and what’s hot in transplantation: basic science ATC
2003. Am J Transplant 3(12): 1474–1480.
Hoffmann SC, Pearl JP, Blair PJ, Kirk AD (2003) Immune profiling: molecular
monitoring in renal transplantation. Front Biosci 8: e444–e462.
Hoffmann SC, Stanley EM, Cox ED, DiMercurio BS, Koziol DE, Harlan DM, Kirk AD,
Blair PJ (2002) Ethnicity greatly influences cytokine gene polymorphism distri-
bution. Am J Transplant 2(6): 560–567.
Hoffmann SC, Stanley EM, Darrin Cox E, Craighead N, DiMercurio BS, Koziol DE,
Harlan DM, Kirk AD, Blair PJ (2001) Association of cytokine polymorphic inher-
itance and in vitro cytokine production in anti-CD3/CD28–stimulated periph-
eral blood lymphocytes. Transplantation 72(8): 1444–1450.
Hutchings A, Purcell WM, Benfield MR (1999) Peripheral blood antigen-presenting
cells from African–Americans exhibit increased CD80 and CD86 expression.
Clin Exp Immunol 118(2): 247–252.
Hutchinson IV (1999) The role of transforming growth factor-beta in transplant
rejection. Transplant Proc 31(7A): 9S–13S.
Solid organ transplant monitoring 267
Hutchinson IV, Pravica V, Sinnott P (2000) Genetic regulation of cytokine synthesis:
Consequence for acute and chronic organ allograft rejection. Graft 56: 281–286.
Ilyas M, Ammons JD, Gaber AO, Roy S, 3rd, Batisky DL, Chesney RW, Jones DP,
Wyatt RJ (1998) Comparable renal graft survival in African–American and
Caucasian recipients. Pediatr Nephrol 12(7): 534–539.
Jabs WJ, Maurmann S, Wagner HJ, Muller-Steinhardt M, Steinhoff J, Fricke L (2004)
Time course and frequency of Epstein–Barr virus reactivation after kidney
transplantation: linkage to renal allograft rejection. J Infect Dis 190(9):
1600–1604.
Kalow W, Tang BK, Endrenyi L (1998) Hypothesis: comparisons of inter- and intra-
individual variations can substitute for twin studies in drug research.
Pharmacogenetics 8(4): 283–289.
Kerman RH, Kimball PM, Van Buren CT, Lewis RM, Kahan BD (1991) Stronger
immune responsiveness of blacks vs whites may account for renal allograft
survival differences. Transplant Proc 23(1) Pt 1: 380–382.
Koop K, Bakker RC, Eikmans M, Baelde HJ, de Heer E, Paul LC, Bruijn JA (2004)
Differentiation between chronic rejection and chronic cyclosporine toxicity by
analysis of renal cortical mRNA. Kidney Int 66(5): 2038–2046.
Kuehnle I, Huls MH, Liu Z, Semmelmann M, Krance RA, Brenner MK, Rooney CM,
Heslop HE (2000) CD20 monoclonal antibody (rituximab) for therapy of
Epstein–Barr virus lymphoma after hemopoietic stem-cell transplantation. Blood
95(4): 1502–1505.
Li B, Hartono C, Ding R, Sharma VK, Ramaswamy R, Qian B, Serur D, Mouradian J,
Schwartz JE, Suthanthiran M (2001) Noninvasive diagnosis of renal-allograft
rejection by measurement of messenger RNA for perforin and granzyme B in
urine. N Engl J Med 344(13): 947–954.
Lindholm A, Welsh M, Alton C, Kahan BD (1992) Demographic factors influencing
cyclosporine pharmacokinetic parameters in patients with uremia: racial differ-
ences in bioavailability. Clin Pharmacol Ther 52(4): 359–371.
Lo A, Egidi MF, Gaber LW, Shokouh-Amiri MH, Nazakatgoo N, Fisher JS, Gaber AO
(2004) Observations regarding the use of sirolimus and tacrolimus in high-risk
cadaveric renal transplantation. Clin Transplant 18(1): 53–61.
Lo A, Stratta RJ, Egidi MF, Shokouh-Amiri MH, Grewal HP, Kizilisik AT, Alloway RR,
Gaber AO (2001) Outcome of simultaneous kidney-pancreas transplantation in
African–American recipients: a case control study. Transplant Proc 33(1–2):
1675–1677.
Louis E, Franchimont D, Piron A, Gevaert Y, Schaaf-Lafontaine N, Roland S, Mahieu
P, Malaise M, De Groote D, Louis R, Belaiche J (1998) Tumour necrosis factor
(TNF) gene polymorphism influences TNF-alpha production in lipopolysaccha-
ride (LPS)-stimulated whole blood cell culture in healthy humans. Clin Exp
Immunol 113(3): 401–406.
Marshall SE, McLaren AJ, McKinney EF, Bird TG, Haldar NA, Bunce M, Morris PJ,
Welsh KI (2001) Donor cytokine genotype influences the development of acute
rejection after renal transplantation. Transplantation 71(3): 469–476.
Moreno JM, Rubio E, Gomez A, Lopez-Monclus J, Herreros A, Revilla J, Navarrete E,
Sanchez Turrion V, Jimenez M, Cuervas-Mons V (2003) Effectiveness and safety
of mycophenolate mofetil as monotherapy in liver transplantation. Transplant
Proc 35(5): 1874–1876.
Muthukumar T, Ding R, Dadhania D, Medeiros M, Li B, Sharma VK, Hartono C, Serur
D, Seshan SV, Volk HD, Reinke P, Kapur S, Suthanthiran M (2003) Serine
proteinase inhibitor-9, an endogenous blocker of granzyme B/perforin lytic
pathway, is hyperexpressed during acute rejection of renal allografts.
Transplantation 75(9): 1565–1570.
Ortiz AM, Troncoso P, Kahan BD (2003) Prevention of renal ischemic reperfusion
268 Real-time PCR
injury using FTY 720 and ICAM-1 antisense oligonucleotides Transplant Proc
35(4): 1571–1574.
Pratschke J, Wilhelm MJ, Kusaka M, Beato F, Milford EL, Hancock WW, Tilney NL
(2000) Accelerated rejection of renal allografts from brain-dead donors. Ann Surg
232(2): 263–271.
Qu L, Green M, Webber S, Reyes J, Ellis D, Rowe D (2000) Epstein–Barr virus gene
expression in the peripheral blood of transplant recipients with persistent circu-
lating virus loads. J Infect Dis 182(4): 1013–1021.
Racusen LC, Solez K, Colvin RB, Bonsib SM, Castro MC, Cavallo T et al. (1999) The
Banff 97 working classification of renal allograft pathology. Kidney Int 55(2):
713–723.
Randhawa P (2001) Role of donor kidney biopsies in renal transplantation.
Transplantation 71(10): 1361–1365.
Sabek O, Dorak MT, Kotb M, Gaber AO, Gaber L (2002) Quantitative detection of T-
cell activation markers by real-time PCR in renal transplant rejection and corre-
lation with histopathologic evaluation. Transplantation 74(5): 701–707.
Sankaran D, Asderakis A, Ashraf S, Roberts IS, Short CD, Dyer PA, Sinnott PJ,
Hutchinson IV (1999) Cytokine gene polymorphisms predict acute graft rejec-
tion following renal transplantation. Kidney Int 56(1): 281–288.
Satterwhite T, Chua MS, Hsieh SC, Chang S, Scandling J, Salvatierra O, Sarwal MM
(2003) Increased expression of cytotoxic effector molecules: different interpreta-
tions for steroid-based and steroid-free immunosuppression. Pediatr Transplant
7(1): 53–58.
Schwartz RH (1992) Costimulation of T lymphocytes: the role of CD28, CTLA-4, and
B7/BB1 in interleukin-2 production and immunotherapy. Cell 71(7): 1065–1068.
Shoker A, George D, Yang H, Baltzan M (2000) Heightened CD40 ligand gene expres-
sion in peripheral CD4+ T cells from patients with kidney allograft rejection.
Transplantation 70(3): 497–505.
Sia IG, Wilson JA, Groettum CM, Espy MJ, Smith TF, Paya CV (2000)
Cytomegalovirus (CMV) DNA load predicts relapsing CMV infection after solid
organ transplantation. J Infect Dis 181(2): 717–720.
Simon T, Opelz G, Wiesel M, Ott RC, Susal C (2003) Serial peripheral blood perforin
and granzyme B gene expression measurements for prediction of acute rejection
in kidney graft recipients. Am J Transplant 3(9): 1121–1127.
Swanson SJ, Hypolite IO, Agodoa LY, Batty DS, Jr, Hshieh PB, Cruess D, Kirk AD,
Peters TG, Abbott KC (2002) Effect of donor factors on early graft survival in
adult cadaveric renal transplantation. Am J Transplant 2(1): 68–75.
Tatapudi RR, Muthukumar T, Dadhania D, Ding R, Li B, Sharma VK, Lozada-Pastorio
E, Seetharamu N, Hartono C, Serur D, Seshan SV, Kapur S, Hancock WW,
Suthanthiran M (2004) Noninvasive detection of renal allograft inflammation
by measurements of mRNA for IP-10 and CXCR3 in urine. Kidney Int 65(6):
2390–2397.
Tornatore KM, Biocevich DM, Reed K, Tousley K, Singh JP, Venuto RC (1995)
Methylprednisolone pharmacokinetics, cortisol response, and adverse effects in
black and white renal transplant recipients. Transplantation 59(5): 729–736.
Tricarico C, Pinzani P, Bianchi S, Paglierani M, Distante V, Pazzagli M, Bustin SA,
Orlando C (2002) Quantitative real-time reverse transcription polymerase chain
reaction: normalization to rRNA or single housekeeping genes is inappropriate
for human tissue biopsies. Anal Biochem 309(2): 293–300.
Turner D, Grant SC, Yonan N, Sheldon S, Dyer PA, Sinnott PJ, Hutchinson IV (1997)
Cytokine gene polymorphism and heart transplant rejection. Transplantation
64(5): 776–779.
USRDS (2000) Annual data report. The National Institutes of Health, The National
Institute of Digestive Diseases and Kidney Diseases, Bethesda, MD.
Solid organ transplant monitoring 269
Verran DJ, deLeon C, Chui AK, Chapman JR (2001) Factors in older cadaveric organ
donors impacting on renal allograft outcome. Clin Transplant 15(1): 1–5.
Wagner HJ, Cheng YC, Huls MH, Gee AP, Kuehnle I, Krance RA, Brenner MK, Rooney
CM, Heslop HE (2004) Prompt versus preemptive intervention for EBV lympho-
proliferative disease. Blood 103(10): 3979–3981.
Yates CR, Zhang W, Song P, Li S, Gaber AO, Kotb M, Honaker MR, Alloway RR,
Meibohm B (2003) The effect of CYP3A5 and MDR1 polymorphic expression on
cyclosporine oral disposition in renal transplant patients. J Clin Pharmacol 43(6):
555–564.
Zheng HX, Zeevi A, McCurry K, Schuetz E, Webber S, Ristich J, Zhang J, Iacono A,
Dauber J, McDade K, Zaldonis D, Lamba J, Burckart GJ (2005) The impact of
pharmacogenomic factors on acute persistent rejection in adult lung transplant
patients. Transpl Immunol 14(1): 37–42.
270 Real-time PCR
Protocol 15.1: Monitoring
solid organ transplant
recipients for rejection
A. URINE, BLOOD, AND BIOPSY PROCESSING
1. Urine 1.1 Urine collection
1.1.1 Urines are to be placed on ice and/or into
the refrigerator immediately after obtain-
ing sample.
1.1.2 Time collected needs to be noted on the
specimen.
1.1.3 Samples need to be processed up at our
earliest opportunity.
1.1.4 Log volume and appearance (cloudy,
clear).
1.2 Urine processing (process within 1 h of
collection).
1.2.1 Spin the total amount of urine for 5 min at
2,200 rpm.
1.2.2 Remove 1 ml urine supernatant and
transfer to a 2 ml freezing vial labeled with
the accession number only and identify it
as urine supernatant. Freeze at −80 in box
provided for viral detection study.
1.2.3 Resuspend the pellet in 1 x PBS and
transfer to a 1.5 ml capped
microcentrifuge tube. Spin for 2.5 min at
3,400 rpm.
1.2.4 Following the wash, remove the
supernatant and resuspend in 0.5 ml
1 x PBS.
1.2.5 Mix 20 μL of this suspension, 20 μL Trypan
Blue and 60 μL 1 x PBS. Count the number
of leukocytes present. Note the presence
of epithelial cells, bacteria, etc.
1.2.6 Pellet the remaining suspension by
spinning at 1,000 rpm, aspirate
supernatant, either add 0.5 ml RNA later
and freeze at 20°C or proceed with RNA
extraction as discussed later.
Solid organ transplant monitoring 271
2. Whole blood 2.1 Whole blood collection
2.1.1 Three 7 ml ACD tubes are to be drawn,
mixed immediately, and kept at room
temperature until picked up.
2.1.2 Check tubes for a complete name, date
drawn, and second identifier, such as DOB.
2.1.3 If there is any danger of the specimen
reaching temperatures less than 60°F, pack
the tubes inside a double container,
preferably Styrofoam.
2.2 Specimen logging
2.2.1 Note the temperature of the specimen if
other than RT when received.
2.2.2 Record total volume prior to spinning;
note the packed cell volume (PCV) and any
hemolysis after spinning.
2.3 Specimen processing
2.3.1 Pour all blood into a 50 ml conical tube.
Note the volume then fill to the 50 mark
with RPMI with 2% FCS. Mix briefly and
spin at 2,200 rpm for 5 min with the brake
in the OFF position.
2.3.2 Aspirate the supernatant to within 1/4 inch
of the buffy coat. Note PCV prior to
doubling the volume in increments of 10
with RPMI with 2% FCS. Mix well by
rocking to break up any leukocyte
clumps.
2.3.3 Overlay 5 ml Ficoll with 10 ml red cell
suspension in a 15 ml conical tube. Spin
for 30 min at 1,400 rpm with the brake on
LOW.
2.3.4 Remove the mononuclear interface to a 15
ml conical tube containing RPMI as soon
as the centrifuge stops. Top the tube off
with RPMI and spin at 1,600 rpm for 5
min. Repeat this wash.
2.3.5 Resuspend the pellet in 2 ml cold 1 x PBS
and count. Specimens containing a large
number of platelets should be rewashed.
Note viability on the worksheet.
2.3.6 Pellet the cells by spinning for 2.5 min at
3,400 rpm aspirate PBS and either
resuspend in 0.5 ml RNA Later and freeze
at −20°C or proceed with the RNA
extraction.
272 Real-time PCR
3. Biopsy Tissue is either stored in RNA Later at −20°C
until it is processed or processed immediately
B. RNA ISOLATION, AND DNASE TREATMENT PROTOCOL
Using RNAqueous™ kit and the manual provided by Ambion
Buffer preparation: 64% ethanol: Add 38.4 ml 100% ACS grade
ethanol to the bottle that contains 21.6 ml
nuclease-free water (provided in the kit) for a final
concentration of 64% ethanol.
Wash solution 2/3: dilute the solution with 64%
ml 100% ACS grade ethanol before use
1. Rinse cells once in PBS by gentle resuspension
and centrifugation, to remove any RNA Later
(Qiagen) solution
2. Remove PBS and add 300 uL lysis/binding
solution per 106 to 107 cells. If the lysate is
extremely viscous, further dilute with
lysis/binding solution
3. Add an equal volume of 64% ethanol and
mix well by repeated pipetting
4. Insert an RNAqueous™ filter cartridge
(Ambion) into one of the RNase-free
collection tubes supplied. Apply the
lysate/ethanol mixture to the filter. 700 μL is
the maximum volume that can be applied at
one time. It is not recommended to exceed
1,800 μL lysate/ethanol mixture per filter
5. Centrifuge for 1 min, discard the flow-through,
and reuse the tube for the washing steps.
6. Wash the filter cartridge with 700-μL wash
solution #1 (provided in kit), centrifuge for 1
min, discard the flow-through, and reuse the
tube for the subsequent washes
7. Wash the filter cartridge twice with 500-μL
wash solution #2/3, centrifuge for 1 min, and
discard the flow-through, centrifuge for an
extra 2 min to remove any traces of wash
solution
8. Transfer filter cartridge to fresh collection
tube. Add 25 μL of elution solution to the
center of the filter. Incubate the tube with
cartridge in a heat block set at 65–70°C, for
10 min. Recover the elute by centrifuging for
1 min
9. To maximize recovery of RNA, repeat step 7,
except do not transfer the cartridge to a fresh
collection tube
Solid organ transplant monitoring 273
10. To measure optical density, take 10 μL of the
eluted RNA and add 90 uL of DEPC water.
Measure the absorbance at 260 nm using the
GeneQuant Pro spectrophotometer
(Amersham Pharmacia Biotechnology)
DNase treatment using DNA-free™ kit and the manual provided by
Ambion.
Use individually wrapped tubes and tips.
1. Add 0.1 volume** of 10X DNase 1 buffer and
1 uL of DNase 1–(2 units) to the RNA. Mix
gently and incubate at 37°C for 20–30 min
2. Add 0.1 volume or 5 μL, whichever is greater,
of the resuspended DNase inactivation
reagent to the sample and mix well
3. Incubate for 2 min at room temperature.
4. Centrifuge the tube for 1 min to pellet the
DNase inactivation reagent
5. RNA should be stored at −80°C until used
** Volume means 0.1X the amount of RNA
C. REAL-TIME PCR PROTOCOL
1. TaqMan® probes and primers.
a. Probes and primers for the gene of
interest are designed using the Primer
Express® software (PE Applied Biosystems,
CA, USA).
b. All primer pairs were designed to produce
amplicons smaller than 150 bp
2. Preparing TaqMan® probes from ABI already
resuspended at 100 μM.
a. A dilution of 1/20 is made to give a 5μM
solution
b. Aliquot the probe solution and store in
the dark at 20°C. It is not recommended
to thaw and freeze more than twice
3. The primers arrive lyophilized with the
amount given on the tube in pmols (such as
150.000 pmol which is equal to 150 nmol).
a. If X nmol of primer is resuspended in
XμL of H2O, the resulting solution is
1 mM
b. Freeze this stock solution in aliquots
c. When the 1 mM stock solution is diluted
1/100, the resulting working solution will
be 10 μM
d. To get the recommended 50–900 nM
final primer concentration in 50 μL
274 Real-time PCR
reaction volume, 0.25–4.50 μL should be
used per reaction (2.5 μL for 500 nM final
concentration)
The pre-developed (PDAR) primers and probes are
supplied as a mix in one tube. It is recommended
to use 2.5 μL in a 50 μL reaction volume.
4. Setting up one-step TaqMan® reaction
Using the TaqMan® EZ RT-PCR kit (PE
Applied Biosystems) and the manual
provided
a) Prepare a reagent mix containing all the
PCR components except target RNA.
Preparing a reagent mix is recommended in
order to increase the accuracy of the results
Reagent mix Volume for one sample Final concentration
RNase-free H2O 14.5 uL [18 uL For PDAR 18S MIX]
®
5X TaqMan EZ buffer 10.0 μL 1X
Manganese acetate (25 mM) 6.0 μL 3 mM
dATP (10 mM) 1.5 μL 300 μM
dCTP (10 mM) 1.5 μL 300 μM
dGTP (10 mM) 1.5 μL 300 μM
dUTP (20 mM) 1.5 μL 600 μM
Primer F (10_M) * 2.5 μL 500 nM
Primer R (10_M) * 2.5 μL 500 nM
®
TaqMan Probe (5 μM)* 1.0 μL 100n M
rTth DNA Polymerase (2.5 U/μL) 0.25 μL 0.1 U/μL
AmpErase UNG (1 U/μL) 0.5 μL 0.01 U/μL
Total mix 45 μL
Target RNA 5 μL
* If a PDAR is used, 2.5 μL of primer + probe mix used
b) Amplification of the target genes tested
and the 18S RNA is to be performed in
duplicate in the same plate
c) In each plate a non-template control
(for each reagent mixture) will be run to
test for any primer-dimmer or
contamination
d) In the case of using an absolute standard
curve or relative standard curve, the
standard must be run in duplicate in each
plate
e) The program consists of heating at 50°C
for 2 min, 60°C for 30 min, and 95°C for
5 min, followed by 40 cycles of a two-
Solid organ transplant monitoring 275
stage temperature profile of 94°C for 20
sec and 62°C for 1 min
f) Accumulation of the PCR products is
detected by directly monitoring the
increase in fluorescence of the reporter
dye
g) Data points collected in this manner are
analyzed at the end of thermal cycling
5. Analyzing and interpreting the results
a) Save the run before it starts by giving it a
name (not as untitled). Also at the end of
the run, first save the data before starting
to analyze
b) The choice of dye component should be
made correctly before data analysis.
Example; if the probe is labeled with FAM
and VIC is chosen there will be some
result but the wrong one
c) When analyzing the data ensure that the
default setting for baseline is 3–15. If any
Ct value is <15, the baseline should be
changed accordingly (the baseline stop
value should be 1–2 smaller than the
smallest Ct value)
d) A threshold for the amplification of each
gene of interest is set by drawing a line
that intersects the exponential phase of
the logarithmic amplification curves for all
samples being analyzed for expression of
target gene (A threshold line should be
drawn above the background noise and
below the plateau region). The cycle
number at which the threshold line
intersects the linear curve for each sample
is used to determine the threshold cycle
(Ct) value
e) Rn+ is the Rn value of a reaction contain-
ing all components; Rn- is the Rn value of
an unreacted sample (baseline value or
the value detected in NTC). ΔRn is the
difference between Rn+ and Rn–. It is an
indicator of the magnitude of the signal
generated by the PCR
Final quantification can be done by any method.
For the purposes of renal transplant monitoring
relative quantification methods are satisfactory
(see Chapters 2, 3, 6, and 7).
Real-time PCR
applications in
hematology
16
Anne M. Sproul
The success of treatment of patients with leukemia is judged by several
criteria. For the patient and clinician the most desirable outcome is
sustained remission from disease and long-term survival. Unfortunately it is
unlikely that complete eradication of leukemic cells is ever achieved.
Hematological remission is defined as fewer than 5% blast cells in the bone
marrow as determined by morphology. Disease levels below this threshold
detected by more sensitive methods such as flow cytometry, cytogenetics
(including FISH), and PCR are referred to as minimal residual disease
(MRD). The sensitivity of PCR has extended the detection limit to one
leukemic cell in one million normal cells.
Although qualitative or endpoint PCR has played a major role in the
diagnosis and monitoring of leukemia, it is now accepted that quantitative
data is more informative. Several large trials including molecular
monitoring have shown that some patients still have PCR detectable
disease during and at the end of treatment, for example the AML1ETO
transcript may persist in AML patients in long-term remission (Jurlander et
al., 1996). Whereas these studies have been able to predict poor outcome
for some patient groups, e.g. PMLRARA positivity at the end of treatment
indicates impending relapse (Lo Coco et al., 1999), it has been more diffi-
cult to gain accurate prognostic information from PCR results, e.g. child-
hood acute lymphoblastic leukemia (ALL) (van Dongen et al., 1998) or
chronic myeloid leukemia (CML) (Hochhaus et al., 2000). However by
measuring the MRD levels it has been shown that it is possible to stratify
risk groups on the basis of MRD level at specific time points in treatment
(Biondi et al., 2000).
Real-time PCR is the only truly quantitative method available. It offers
other advantages over conventional PCR, for example more rapid turn-
around as no post PCR processing is necessary and since closed systems are
used the risk of contamination is abolished. These are important in diagnos-
tic laboratories. This chapter refers to real-time PCR using hydrolysis or
TaqMan® probes; this reflects the author’s personal experience not bias. The
same analyses can be performed using hybridization probes and should be
regarded as interchangeable. However the reagents referred to have been
designed for assays using probes and are not validated for the use of DNA-
binding dyes such as SYBR® Green 1.
278 Real-time PCR
16.1 Specimens
Bone marrow aspirates are the most common specimen for MRD monitor-
ing in acute leukemia. Peripheral blood is also used but the sensitivity is at
least ten-fold lower than in marrow. For patients in the early stages of treat-
ment, blood may be used; however to achieve maximal sensitivity bone
marrow should be analyzed wherever possible. Peripheral blood monitoring
is preferred for patients with CML.
16.2 Specimen quality
It is sometimes difficult to obtain good quality specimens for molecular
analysis; there are often conflicting demands on the clinician obtaining the
specimen to provide specimens for morphology, flow cytometry, and
cytogenetics in addition. This may result in clotted or small specimens. The
amount of nucleic acid isolated may be very low. Specimens may be posted
to a central laboratory for analysis and be more than 48 hours old. These
factors must be borne in mind when addressing the matter of sensitivity;
even the best assay is reliant on the quantity of input material; one cannot
assume a sensitivity of 10–5 if only 104 molecules were analyzed.
16.3 Template preparation
Sensitive accurate quantitative PCR relies on the use of high-quality
templates, the protocols below work and relatively simple and inexpensive;
however there are several other methods that work equally well.
16.4 DNA isolation
The choice of DNA extraction method is determined by several factors;
DNA yield and quality, convenience, cost and individual preferences.
Although PCR can yield results from very poor specimens, e.g. forensic
material, the use of poor quality specimens will compromise accurate and
sensitive diagnosis. The exception to this is the use of paraffin embedded
tissues for the extraction of nucleic acids. This valuable diagnostic resource
can yield DNA suitable for analysis; however, the quality of the isolated
DNA is dependent on the treatment of the tissue prior to and during
fixation. The DNA will be of lower molecular weight, however due to the
smaller amplicons suited to real-time PCR, good results can be obtained.
Many commercially available kits produce high-quality DNA preparations
that are good templates for real-time PCR, however one drawback is the low
concentration of the DNA produced. Whilst these amplify very efficiently;
there may be too few DNA molecules to ensure maximal sensitivity.
16.5 PCR inhibition
Some DNA specimens may be contaminated with inhibitors of PCR. This
becomes apparent when values obtained from standard curves to not corre-
late with DNA concentration calculated from optical density readings.
Moppet et al. (2003) have demonstrated that the addition of bovine serum
Real-time PCR applications in hematology 279
albumin (0.04% final concentration) to the PCR mix can overcome some
degree of inhibition.
16.6 RNA isolation
Solvent based methods using commercially available reagents such as Tri-
Reagent® (Sigma) or Trizol® (Invitrogen) are simple and adaptable to varying
cell numbers, but involve the use of toxic, organic solvents. Column based
kits, from suppliers such as Qiagen and Promega, circumvent the use of
organic solvents but are far less flexible in terms of increasing cell numbers.
If centrifugation of the columns is performed the process becomes tedious
for more than a few specimens and cross contamination is more likely. If
large numbers of specimens are to be processed the use of vacuum compat-
ible columns is recommended. As with DNA preparation for MRD studies,
the final RNA concentration may not be sufficiently high.
DNA contamination is a frequent problem of RNA preparation. Although
most applications will design the real-time PCR primers and probes to span
exons (some genes are single exons and this is not possible), cDNA synthe-
sis and subsequent PCR may be less efficient and sensitivity reduced due to
lower input of cDNA. Removal of contaminating DNA by DNase digestion
is easily carried out by utilizing RNase-free DNase followed by the Rneasy
Minelute Kit (Qiagen). Our laboratory uses Tri-Reagent® for routine isola-
tion of total RNA from blood and marrow cells.
Specimens for RNA based MRD analysis should be processed as soon as
possible to prevent decrease in sensitivity due to RNA degradation. Blood
specimens may be drawn directly into PAXgene tubes (Qiagen), however
these are expensive, but are of great value as blood specimens may be
shipped at room temperature without RNA degradation.
16.7 cDNA synthesis
The choice of primer for cDNA synthesis should reflect the downstream
PCR requirements. Diagnostic real-time RT-PCR will require amplification
of at least one control transcript and the specific test sequence. Therefore
the use of specific reverse PCR primers to prime cDNA synthesis is not
recommended as separate cDNA reactions would be required and subse-
quent analysis of other sequences would require further cDNA synthesis.
However, if maximum sensitivity is required, cDNA synthesis using the
downstream PCR primer will increase the yield of sequence specific PCR
product.
Oligo d(T) priming utilizing the poly(A) tail present at the 3’ end of most
(but not all) mRNA molecules is used in many applications. It has the major
advantage of priming cDNA synthesis almost exclusively from mRNA.
However, for detection of fusion transcripts in leukemia, this method
results in lower sensitivity, as many of the fusions occur towards the 5’ end
of the mRNA molecule and oligo d(T) primed cDNA is heavily biased
towards 3’ ends. It is also less tolerant of slightly degraded RNA templates.
Random priming using random hexamers is the method of choice for
most applications in leukemia diagnosis and MRD monitoring. The cDNA
produced is representative of the entire expressed RNA population; this
280 Real-time PCR
does include the major component of cellular RNA the ribosomal RNA
(rRNA), however this does not appear to compromise the sensitivity of real-
time PCR. The Europe against Cancer (EAC) program designed and
validated primer and probe combinations for the identification and
monitoring of fusion transcripts in leukemia (Gabert et al., 2003). Optimal
conditions for cDNA synthesis were also investigated and the recom-
mended protocol is used in our laboratory.
16.8 Relative versus absolute quantitation
There are strong arguments for the use of standard curves and absolute
quantitation; however most clinicians want to know how an individual
patient is responding to treatment. There has been much discussion of the
most meaningful units for expression of MRD results; copies/μL of blood
(most MRD monitoring for acute leukemia is performed on bone marrow);
copies/μg of RNA (this is only an indication of the RNA concentration and
cDNA synthesis efficiency). Perhaps the most useful is to express the ratio of
test gene to a control gene expression level (i.e. the target amount is divided
by the control gene amount to obtain a normalized target value), however
this is an expensive option. Most diagnostic laboratories insist on the inclu-
sion of standard curves with each batch of test samples. Centers dealing
with leukemia patient samples require to provide quick turnaround time;
may have limited budgets; have access to a shared instrument only, and
perform multiple assays per run; therefore multiple standard curves prove
expensive for small numbers of specimens. Larger centers with high
throughput use absolute quantitation; the reproducibility achieved by the
best instruments is such that it is not necessary to run a standard curve with
each batch of specimens. However, the principal investigator must ensure
that the standard curve data are robust and not subject to individual opera-
tor variation; it is vital that the low control is included in each run if sensi-
tivity is being reported. Figure 16.1 illustrates the use of absolute
quantitation of BCRABL and ABL and Figure 16.2 illustrates the expression
of the results as a percentage ratio of BCRABL/ABL of an individual patient.
Relative quantitation using the diagnostic specimen as the calibrator may
be the method of choice. Results can be expressed as log reduction from the
time of diagnosis. This is informative to the clinician and patient. Reports
must state clearly that the transcript level is relative to the diagnostic level,
not the sensitivity of the assay as ΔΔCt can result in MRD levels of <1.00E-07.
Once validated, relative quantitation assays are convenient to run as multiple
assays can be performed on one plate. Cell lines may be used as sources
of calibrator samples; however the data obtained are relative to an arbitrary
calibrator and do not reflect the percentage of malignant cells directly, this
approach is useful for examining serial specimens from patients.
The final choice of method will depend on the circumstances of the
individual patient and laboratory. Our laboratory uses both absolute
quantitation expressing results as a ratio of test gene to control gene and
relative quantitation using the individual patient’s diagnostic sample as
calibrator for their follow-up specimens. However the transcript ratio is
established for the diagnostic sample by absolute quantitation and regular
quality control is performed using standard curves.
Real-time PCR applications in hematology 281
Figure 16.1
Standard curves for absolute quantitation of BCRABL in patients undergoing
treatment for CML using cABL as control gene.
16.9 Control genes for MRD in leukemia
Whether absolute or relative quantitation is carried out, the choice of
control gene is very important. Older publications refer to sequences such
as β-actin, GAPDH or 18S ribosomal RNA for gene expression assays. The
first two have pseudogenes and inaccuracies may result from DNA contam-
ination, the latter is expressed at very high levels and is not a suitable
control for single copy genes without limiting primer concentrations. Both
test and control genes must amplify with the same efficiency for the ΔΔCt
method to be valid. Another important consideration is that the expression
of the control gene may be influenced by the treatment the patient is
282 Real-time PCR
BCRABL timecourse
1000 2
䊏 BCRABL/ABL
䉱 Log reduction 1
䊏
100
0
BCRABL/ABL ratio %
10
Log reduction
–1
1 –2
䊏
䉱
䊏
䉱 –3
0.1
䉱
䉱 䊏 –4
䊏 䉱
0.01 䊏
–5
0.001 –6
0.00 3.27 5.13 7.93 14.47 18.20
Time (months)
Figure 16.2
Tracking response to therapy in a patient with CML.
undergoing and should remain stable during the course of treatment. The
Europe Against Cancer (EAC) project addressed the choice of control genes
(Beillard et al., 2003); ABL, GUS, and B2M (β-2- microglobulin) emerged as
the most suitable. For genomic DNA targets recommended control genes
include B2M, ALB (albumin), and HBB (β-globin).
16.10 Controls for real-time PCR
The use of appropriate controls is vital for accurate diagnostic PCR. If
absolute quantitation is performed the most convenient standard is a
plasmid containing the target sequence. Kits for cloning of PCR products
are available from many sources, but some expertise in manipulation of
plasmids and bacteria is required. Plasmid standards for many of the
common fusion transcripts are available commercially (for example, from
Ipsogen, Marseille, France). cDNA produced from in vitro transcribed RNA
can also be used to generate standard curves; however it cannot be assumed
that the efficiency of reverse transcription is equal to that of the test speci-
mens; also the RNA is subject to degradation.
Plasmid DNA should be isolated using high-quality commercial kits such
as those manufactured by Qiagen or Promega. The concentration of the
purified DNA should be determined accurately. It is vital that the size
(assuming a molecular weight of 660 kD for a base pair) of the plasmid and
the inserted sequence are known in order to calculate the number of
Real-time PCR applications in hematology 283
molecules per microlitre using Avogadro’s number (see Chapter 2). As DNA
can stick to the walls of test tubes; it is advisable to use carrier DNA. We
prepare our plasmid dilutions in a solution of 10 μg/ml lambda phage DNA
in 0.1x TE (Tris-EDTA) buffer. The choice of carrier DNA should be consid-
ered carefully to ensure that there is no cross reactivity with PCR primers
and probes. The range of standard concentrations should reflect the
dynamic range of the assay and the values expected from patient samples;
in practice this is often from 106 to less than 10 molecules per microlitre.
Standards should be aliquoted and stocks stored at –20°C, working aliquots
should be stored at 4°C. These should be discarded when the reproducibil-
ity of the lower copy number replicates deteriorates (usually between one to
six months).
In addition to positive controls negative controls must also be incorpo-
rated; ideally these should include reagent blanks for all stages of processing
and PCR master mix containing probes and primers but no template
control (NTC). In practice we include a specimen processed in the same
batch as the test samples but known to be negative for the target being
analyzed (NAC; no amplification control).
16.11 Assay design
Design of primers and probes has been described elsewhere (see Chapters 5
and 7). The value of standardized reagents cannot be stressed highly
enough (Gabert et al., 2003). However, where this is not possible, sequenc-
ing and design of patient specific reagents can be successful. Sufficient
template should be added to ensure adequate sensitivity. The number of
replicates required varies with application; however most laboratories
would consider three to be the minimum for accurate quantitation and
removal of outliers. The definition of replicate also varies; some centers
process separate aliquots of cells, but it is more common to process one
batch and set up multiple wells adding DNA or cDNA to the individual
wells. If only one replicate is positive with a high Ct, the result should be
confirmed using more replicates.
16.12 Laboratory precautions
The measures necessary to prevent PCR contamination in real-time PCR are
broadly similar to those required for qualitative PCR. Due to the nature of
the PCR process, contamination is a major potential problem.
Contamination with PCR products may lead to false positive results.
Unexpected positive PCR may result in the patient requiring re-sampling
and cause unnecessary anxiety. There should be separate laboratories for
specimen preparation, reagent preparation, PCR set-up and post-PCR
processing. Although one of the major advantages of real-time PCR is that
there is no need for post-PCR processing, many laboratories carry out quali-
tative PCR for the same target sequences. If it is not possible to have
separate laboratories, careful consideration should be given to the design
and utilization of the available space. Personal experience has shown that
the majority of contamination problems occur during specimen processing
where large numbers of specimens are being handled at one time.
284 Real-time PCR
16.13 PCR reaction set-up
PCR reactions should be set up in a dedicated laboratory adhering to clini-
cal diagnostic laboratory rules. It may be recommended that a laminar flow
cabinet with means of ultra-violet sterilization should be used. Opinion is
divided on the necessity of laminar flow conditions; the operator may be
lulled into a false sense of security and not heed the basic rules for setting
up PCR.
1. Use aerosol resistant tips
2. Use dedicated micropipettes only. Reproducibility between runs will be
affected by the use of different pipettes
3. If possible reagents, such as primer and probe stocks, and homemade
master, should be prepared and aliquoted on an entirely separate site.
Use the smallest aliquots that are practical. Discard empty containers;
do not refill. Always discard an aliquot if contamination is suspected
4. Protect reagents for real-time PCR from light. Store aliquots in amber
tubes
5. Wear gloves at all times and change frequently
6. Wear disposable gowns or keep a set of laboratory coats for PCR set-up.
If different laboratories are used, change laboratory coats between
areas
7. Be aware of aerosol generation. Centrifuge specimen tubes to ensure
that there is no DNA/cDNA on the caps that may contaminate your gloves
8. Isolate known positive specimens from expected low level MRD speci-
mens
9. Include NTC and NAC controls
10. Use dUTP and UNG containing master mixes
The use of plasmids as positive controls may be unavoidable; however
concentrated plasmid DNA solutions contain very high numbers of target
molecules. If possible plasmid DNA isolation and standard preparation
should be carried out in a separate location. If possible, seal the PCR vessels
containing test samples and negative controls before pipetting positive
controls whether they are plasmid or cell line cDNA/DNA.
16.14 Interpretation and quantitation
A sample is considered positive if the Ct value is less than the number of
cycles performed. However this does not mean that quantitation is possible
in every case. Accurate quantitation is only possible within the reproducible
range of the assay, i.e. higher or equal to the reproducible sensitivity. For
plasmid controls this is usually between five and ten copies.
‘Negative specimens’ are those where no amplification has occurred and
the control gene amplification is satisfactory (see below). A sample can also
be considered negative if the lowest Ct is within the range of the NAC
controls or if all of its Ct values are more than 4 cycles apart from the
highest Ct of the maximal sensitivity control.
Arbitrary cut-off values for control gene levels may be set. For RT-PCR in
our laboratory we do not report a test sequence as ‘undetected’ if the cABL
Real-time PCR applications in hematology 285
copy number is less than 104 copies per microlitre of cDNA or if the mean
Ct is greater than 30. Specimens that fail to achieve the above criteria would
be re-purified and concentrated prior to reverse transcription, as the most
common reasons for such failures are DNA contamination, low RNA
concentration or RNA degradation. Examination of RNA integrity can be
performed using the Agilent 2100 Bioanalyser (Agilent Technologies) or gel
electrophoresis. However RNA degradation is rare in fresh samples properly
processed. If the sample was more than 48 hours old at the time of process-
ing some RNA turnover/degradation is inevitable, clinical reports of
negative findings should include comments regarding time to receipt of
specimens.
16.15 Sensitivity
The sensitivity that can be obtained by real-time PCR analysis depends on
several variables; some target independent and specimen dependent, i.e.
specimen sensitivity; others dependent on the nature of the target, i.e. assay
sensitivity. The assay sensitivity can be established by performing dilution
experiments, these can be dilutions of patient material, cell lines or
plasmids. The potential presence of fusion genes in healthy individuals
means that MRD levels of less than 10–6 should be interpreted with caution.
Sensitivity of allele-specific oligonucleotide (ASO) assays for rearranged
antigen receptor genes are usually established by performing dilution of the
patient’s leukemic cell DNA in mononuclear cell DNA from several donors.
However, the values obtained do not reflect the sensitivity obtained for
the actual test sample. This is dependent on the quality and quantity of the
template used. If absolute quantitation has been used, specimen sensitivity
can be estimated by dividing the maximal reproducible sensitivity of the
test gene by the copy number of the control gene, e.g. in an assay where the
10 copy/l standard is the limit of reproducibility and the ABL gene copy
number is 2.3 × 104/μl; the sensitivity is 10/2.34 × 104or 4.27 × 10–4.
For DNA based ASO approaches the test DNA is usually quantified by
amplification of a control gene such as B2M or ALB in an absolute quanti-
tation assay using genomic DNA of known concentration to prepare
standards.
16.16 Targets for detecting MRD
16.16.1 Fusion transcripts
The recurrent chromosome translocations in leukemia are excellent targets
for the tracking of residual disease in patients undergoing treatment. The
fusion genes that result from the chromosome rearrangements are specific
(in the main) for leukemic cells. PCR assays that use primers complimentary
to the fusion partners can be highly sensitive due to very low or absent
background. However, some leukemia specific fusion transcripts, such as
BCRABL, are found in a significant proportion of healthy individuals (Bose
et al., 1998). Sensitivities equivalent to one positive cell in one hundred
thousand negative cells can be achieved by nested qualitative RT-PCR
reactions. RT-PCR is applicable to the detection of fusion transcripts due to
286 Real-time PCR
the great distances spanned by the introns in the partner genes. The use of
the spliced RNA transcript not only overcomes the problem of long PCR; it
increases the sensitivity due to the presence of multiple copies of the fusion
transcript rather than the single copy of the rearranged gene. However, the
labile nature of RNA is a major disadvantage in the use of RT-PCR assays as
diagnostic tests. Not only does RNA degrade as cells lose viability; purified
RNA is vulnerable to the ubiquitous presence of ribonucleases in the labora-
tory environment. The problems associated with the use of RNA can be
minimized with a few sensible precautions in the laboratory and the
optimization of specimen collection and delivery.
As quantitative gene expression has been described in great detail in
Chapter 7, another complete protocol is not presented. A brief outline of
our protocol for the quantitation of BCRABL in patients with CML treated
with imatinib is given as an example.
• We perform gene expression TaqMan® assays using 10 μl assays per
well. This is possible as 1 μl of cDNA may be dispensed accurately
(however it is difficult to dispense such small volumes of concentrated
genomic DNA)
• Do not dilute cDNA from patients on imatinib therapy
• Prepare large stocks of diluted probe and primers and store in small
aliquots in amber tubes at –20°C
Constituent Volume Volume per
per well 96-well plate
Molecular biology grade H2O 3 μl 315 μl
10 μM forward primer 0.3 μl 31.5 μl
10 μM reverse primer 0.3 μl 31.5 μl
5 μM TaqMan® probe 0.4 μl 42 μl
• Each well should contain:
2X Master mix 5 μl
Probe and primer mix 4 μl
Template (cDNA or plasmid) 1 μl
• Standard curves for both BCRABL and ABL are used on each run. We use
an in-house plasmid construct that contains a full-length b3a2 BCRABL
transcript, permitting the same plasmid to be used for both. We use the
plasmid standards from Ipsogen to calibrate our own preparations.
However, both BCRABL and ABL standards must be purchased, as they
are different constructs
• Use triplicate reactions for all tests and controls
• Carry out 50 cycles of PCR to ensure that samples with high Ct values
represent true amplification
• Analyze results and examine replicates
• Export results to Microsoft Excel
• Express results as BCRABL/total ABL × 100
• Express individual specimen sensitivity as last reproducible point on
standard curve/ABL copy number
Real-time PCR applications in hematology 287
16.16.2 Rearrangements of immunoglobulin/TCR genes in
lymphoid neoplasia
The rearrangement of multiple gene segments to form functional
immunoglobulin or T-cell receptor genes occur early in lymphocyte devel-
opment and each lymphocyte has a particular combination of variable (V),
diversity (D) and joining (J) segments. The junctional regions V-(D)-J are
clonal markers of lymphoid neoplasia and can be used as targets for diagno-
sis and disease tracking. However the ‘uniqueness’ of each rearrangement
means that it is not possible to use standardized real-time PCR reagents; in
most instances individual clonal rearrangements are sequenced and primers
and/or probes are designed. As probes are the most costly component in a
real-time PCR assay, it would be prohibitively expensive to design patient
specific probes. Therefore, several groups have designed assays using one
ASO primer and a germline primer and probe (Figure 16.3). This reduces the
complexity of the assays as only one forward primer be designed, although
in practice at least three versions of the ASO are designed. These approaches
are discussed in depth by (van der Velden et al., 2003). The use of ASO
primers in lymphoid malignancies is highly specialized and requires experi-
ence in design and testing of reagents to produce the highly sensitive and
Variable gene segments Diversity genes Joining genes Constant region
NH3 COOH
V-D-J
Recombination
ACG
GAG
CT GAG
GGG
GGG
NH3 NNNN NNN COOH
TaqMan® probe
Forward primer R Q
DNJ Consensus
Reverse primer
region region
Figure 16.3
Generation of allele specific primers for MRD quantitation.
288 Real-time PCR
specific assays required for monitoring and adapting treatment. However,
due to the background of similar rearrangements and limited repertoire at
some loci, these assays do not routinely achieve the sensitivity and speci-
ficity of those using chromosome translocations as targets.
References
Beillard E, Pallisgaard N, Van der Velden VH, BI W, Dee R, Van der Schoot E,
Delabesse E, Macintyre E, Gottardi E, Saglio G, Watzinger F, Lion T, Van Dongen
JJ, Hokland P, Gabert J (2003) Evaluation of candidate control genes for diagno-
sis and residual disease detection in leukemic patients using ‘real-time’ quanti-
tative reverse-transcriptase polymerase chain reaction (RQ-PCR) – a Europe
against cancer program. Leukemia 17(12): 2474–2486.
Biondi A, Valsecchi MG, Seriu T, D’Aniello E, Willemse MJ, Fasching K, Pannunzio A,
Gadner H, Schrappe M, Kamps WA, Bartram CR, Van Dongen JJ, Panzer-
Grumayer ER (2000) Molecular detection of minimal residual disease is a strong
predictive factor of relapse in childhood B-lineage acute lymphoblastic leukemia
with medium risk features. A case control study of the International BFM study
group. Leukemia 14(11): 1939–1943.
Bose S, Deininger M, Gora-Tybor J, Goldman JM, Melo JV (1998) The presence of
typical and atypical BCR-ABL fusion genes in leukocytes of normal individuals:
biologic significance and implications for the assessment of minimal residual
disease. Blood 92(9): 3362–3367.
Fehse B, Chukhlovin A, Kuhlcke K, Marinetz O, Vorwig O, Renges H, Kruger W,
Zabelina T, Dudina O, Finckenstein FG, Kroger N, Kabisch H, Hochhaus A,
Zander AR (2001) Real-time quantitative Y chromosome-specific PCR (QYCS-
PCR) for monitoring hematopoietic chimerism after sex-mismatched allogeneic
stem cell transplantation. Journal of Hematotherapy & Stem Cell Research, 10(3):
419–425.
Gabert J, Beillard E, Van der Velden VH, Bi W, Grimwade D, Pallisgaard N, Barbany
G, Cazzaniga G, Cayuela JM, Cave H, Pane F, Aerts JL, De Micheli D, Thirion X,
Pradel V, Gonzalez M, Viehmann S, Malec M, Saglio G, Van Dongen JJ (2003)
Standardization and quality control studies of ‘real-time’ quantitative reverse
transcriptase polymerase chain reaction of fusion gene transcripts for residual
disease detection in leukemia – a Europe Against Cancer program. [Review].
Leukemia 17(12): 2318–2357.
Hochhaus A, Weisser A, La Rosee P, Emig M, Muller MC, Saussele S, Reiter A, Kuhn C,
Berger U, Hehlmann R, Cross NC (2000) Detection and quantification of residual
disease in chronic myelogenous leukemia. [Review]. Leukemia 14(6): 998–1005.
Jurlander J, Caligiuri MA, Ruutu T, Baer MR, Strout MP, Oberkircher AR, Hoffmann
L, Ball ED, Frei-Lahr DA, Christiansen NP, Block AM, Knuutila S, Herzig GP,
Bloomfield CD (1996) Persistence of the AML1/ETO fusion transcript in patients
treated with allogeneic bone marrow transplantation for t(8;21) leukemia. Blood
88(6): 2183–2191.
Langerak AW, Szczepanski T, Van der Burg M, Wolvers-Tettero IL, Van Dongen JJ,
(1997) Heteroduplex PCR analysis of rearranged T cell receptor genes for clonal-
ity assessment in suspect T cell proliferations. Leukemia 11(12): 2192–2199.
Lo Coco F, Diverio D, Falini B, Biondi A, Nervi C, Pelicci PG (1999) Genetic diagnosis
and molecular monitoring in the management of acute promyelocytic
leukemia. [Review]. Blood 94(1): 12–22.
Maas F, Schaap N, Kolen S, Zoetbrood A, Buno I, Dolstra H, De Witte T, Schattenberg
A, Van de Wiel-van Kemenade E (2003) Quantification of donor and recipient
hemopoietic cells by real-time PCR of single nucleotide polymorphisms.
Leukemia 17(3): 630–633.
Real-time PCR applications in hematology 289
Moppett J, Van der Velden VH, Wijkhuijs AJ, Hancock J, Van Dongen JJ, Goulden N
(2003) Inhibition affecting RQ-PCR-based assessment of minimal residual
disease in acute lymphoblastic leukemia: reversal by addition of bovine serum
albumin. Leukemia 17(1): 268–270.
Pongers-Willemse MJ, Seriu T, Stolz F, D’Aniello E, Gameiro P, Pisa P, Gonzalez M,
Bartram CR, Panzer-Grumayer ER, Biondi A, San Miguel JF, Van Dongen JJ
(1999) Primers and protocols for standardized detection of minimal residual
disease in acute lymphoblastic leukemia using immunoglobulin and T cell
receptor gene rearrangements and TAL1 deletions as PCR targets: report of the
BIOMED-1 CONCERTED ACTION: investigation of minimal residual disease in
acute leukemia.[see comment]. Leukemia 13(1): 110–118.
Van der Velden VH, Hochhaus A, Cazzaniga G, Szczepanski T, Gabert J, Van Dongen
JJ (2003) Detection of minimal residual disease in hematologic malignancies by
real-time quantitative PCR: principles, approaches, and laboratory aspects.
[Review]. Leukemia 17(6): 1013–1034.
Van der Velden VH, Wijkhuijs JM, Jacobs DC, Van Wering ER, Van Dongen JJ (2002)
T cell receptor gamma gene rearrangements as targets for detection of minimal
residual disease in acute lymphoblastic leukemia by real-time quantitative PCR
analysis. Leukemia 16(7): 1372–1380.
Van der Velden VH, Willemse MJ, Van der Schoot CE, Hahlen K, Van Wering ER,
Van Dongen JJ (2002) Immunoglobulin kappa deleting element rearrangements
in precursor-B acute lymphoblastic leukemia are stable targets for detection of
minimal residual disease by real-time quantitative PCR. Leukemia 16(5):
928–936.
Van Dongen JJ, Seriu T, Panzer-Grumayer ER, Biondi A, Pongers-Willemse MJ, Corral
L, Stolz F, Schrappe M, Masera G, Kamps WA, Gadner H, Van Wering ER, Ludwig
WD, Basso G, De Bruijn MA, Cazzaniga G, Hettinger K, Van der Does-Van der
Berg A, Hop WC, Riehm H, Bartram CR (1998) Prognostic value of minimal
residual disease in acute lymphoblastic leukemia in childhood. Lancet
352(9142): 1731–1738.
Verhagen OJ, Willemse MJ, Breunis WB, Wijkhuijs AJ, Jacobs DC, Joosten SA, Van
Wering ER, Van Dongen JJ, Van der Schoot CE (2000) Application of germline
IGH probes in real-time quantitative PCR for the detection of minimal residual
disease in acute lymphoblastic leukemia. Leukemia 14(8): 1426–1435.
290 Real-time PCR
Protocol 16.1:
Post-transplant MRD
monitoring
OUTLINE
This is a complex technique involving several steps. The major processes are:
1. Identify an individual patient’s monoclonal rearrangements and perform
sequencing
2. Design and order clone specific forward primers for at least 2 separate loci
3. Prepare control DNA from the pooled mononuclear cells up at least 10
normal donors
4. Prepare dilution series of patient’s diagnostic DNA in control DNA
5. Test clone specific primers for sensitivity and specificity. Re-design and re-
test if necessary
6. Test remission specimens from the individual patient and calculate the
level of MRD relative to the diagnostic specimen using the standard curve
Reagents and consumables
PCR primers for chosen antigen receptor
rearrangements
Polyacrylamide gel solution (Sigma, 40% Stock,
29:1 bis: acrylamide)
TRIS borate EDTA electrophoresis buffer
DNA Sequencing Kit
Germline reverse primers and TaqMan® probes
(Verhagen et al., 2000; van der Velden et al.,
2002; van der Velden et al., 2002)
Control gene TaqMan® assay, e.g ALB (Verhagen
et al., 2000)
2 x TaqMan® universal master mix (Applied
Biosystems)
TE Buffer (10mM TRIS, 1mM EDTA, pH 8.0)
Molecular biology grade H2O
96-well PCR plates
Optical quality adhesive covers or caps
Equipment
Thermal Cycler
Real-time PCR instrument such as ABI 7500
Real-time PCR applications in hematology 291
Genespec Micro spectrophotometer (Hitachi)
Vertical polyacrylamide electrophoresis apparatus
(SE 600 Ruby, GE Healthcare)
PCR micropipettes
Waterbath at 37°C
Microcentrifuge
Benchtop centrifuge with microplate carriers
Specimens required
• DNA from patient at presentation (marrow or
blood should contain >90% leukemic cells).
Adjust concentration to 100 ng/μl
• DNA from pooled mononuclear cells from at
least 10 healthy donors (concentration as
above). This will be the non-amplified control
(NAC) and will also be used as diluent for
dilution series of patient’s diagnostic DNA.
Leukemic cell DNA in a background of
polyclonal lymphocyte DNA mimics the DNA
isolated from the patient in remission. It will
also be used to prepare dilutions for control
gene standard curve
• DNA from patient during treatment at
100 ng/μl
Identify clonal rearrangements
Analyze the patient’s diagnostic DNA using PCR
assays for IgH, TCRδ, TCRγ and kappa deleting
element (KDE) as described (Pongers-Willemse et
al., 1999) and identify suitable rearrangements by
heteroduplex analysis (Langerak et al., 1997).
Select monoclonal rearrangements with no
evidence of heteroduplex formation. If possible at
least two rearrangements from different loci
should be selected, e.g. IgH or TCR. Where there
has been sufficient resolution of clonal bands they
may be excised from the gel and sequenced.
Analyze the sequence using software available at
http://www.ncbi.nlm.nih.gov/igblast,
http://imgt.cines.fr/textes/vquest, or
http://vbase.mrc-cpe.cam.ac.uk/vbase1/
dnaplot2.php to designate the gene segments
involved in the junctional region
Design of clone specific forward primer
Forward patient specific primers are designed
(Primer Express®, Applied Biosystems) to lie over
292 Real-time PCR
the area of clone specific rearrangement. In the
case of IgH, this should be the DNJ junction as
opposed to the VND junction, to minimize the
risk of clonal evolution. For TCRγ targets the
primer should lie over the VND or DND junction,
and for γ deleting elements KDE the VNKDE join.
For maximal specificity avoid including anymore
than 3–5 bases in the germline sequence at the 3’
end. In practice this can be very difficult to
achieve with some delta and many kappa targets.
Due to the more limited diversity of TCR
rearrangements, the germline probe assay
sensitivity is dependent upon the rearrangement
present and the number of insertions present.
Rearrangements containing >12 insertions and
deletions provide useful markers whilst those with
<12 are unlikely to be specific (van der Velden et
al., 2002).
Criteria for an acceptable forward primer (in addition to the rules listed
in Chapter 7, Table 1)
• Tm of 57–60°C on Primer Express® using
Nearest Neighbor algorithm
• Choose shortest primer with the least number
of germline nucleotides
• Check for the presence of 3’ forward/forward
and forward/reverse primer-dimmers and for
possible 3’ hairpin formation
• In practice, with some rearrangements it is
impossible to meet these criteria, however,
primers with >3 G/C at the 3’ end do not
work well
• If Primer Express® will not identify a primer
with an appropriate Tm in the region of
interest, (particularly common with IgH),
primers may be designed by eye and using
the Wallace rule (Tm = 4(G + C) + 2(A + T)
aim for Tm = 55 – 60°C), using a 2–3 base
overhang into consensus at the 3’ end
• Design three candidate primers per locus and
order from a reliable supplier
Control PCR A suitable control PCR must be run. The control
PCR is used to confirm the amount and quality
of amplifiable DNA in each sample analyzed for
MRD. It is thus simultaneously a check for the
accuracy of DNA quantitation, accuracy of
pipetting and for the presence of PCR inhibitors.
Real-time PCR applications in hematology 293
As all test PCRs use 500 ng of test DNA, the
control standard curve needs to cover this range
only. The UK Childhood Leukaemia Network use
ALB, other European groups use B2M, our
laboratory uses ALB. Other control genes may be
used but their chromosomal location should be
considered in order to avoid loci that may be
deleted or amplified in a particular leukemia.
A standard curve should be constructed from
duplicate analysis of a dilution series made from
pooled normal control DNA. Dilute the DNA in
TE. Only the 100, 10–1,10–2, and 10–3 points need
be analyzed.
Generating standard curves for assessment of probe sensitivity and
measurement of MRD
A dilution series in which leukemic DNA is diluted
with pooled normal blood mononuclear cell DNA
is used to generate the standard curve.
Preparation of patient DNA dilution series for TaqMan® MRD analysis
Dilution point Quantity of leukemic Volume of Volume of
(target) DNA target DNA control DNA
100 1000 ng –
10–1 100 ng 10 μl 90 μl
10–2 10 ng 10 μl 90 μ
10–3 1000 pg 10 μl 90 μ
10–4 100 pg 10 μl 90 μ
10–5 10 pg 10 μl 90 μ
10–6 1 pg 10 μl 90 μ
1. Adjust concentration of presentation DNA
(containing >90% leukemic cells) to 100
ng/ml. Warm in 37°C waterbath for 1 h to
ensure that the solution is homogenous,
vortex briefly and spin down
2. 10–1 Point: 1000 ng (10 μl of 100 ng/μl
solution) of target DNA is added to 90 μl of
pooled normal donor peripheral blood
mononuclear cell DNA (100 ng/μl), making a
final solution of 10 ng/μl target DNA. 5 μl of
this solution is then used in TaqMan® PCR
representing 50 ng of target (= 10–1 point)
3. 10–2 Point: Leave 10–1 point in water bath for
1 h, vortex and spin down. 10 μl of 10–1
294 Real-time PCR
solution is added to 90 μl of pooled normal
DNA (100 ng/μl), to make 10–2 point
4. Repeat step 2 four more times to make 10–3,
10–4, 10–5, and 10–6 points
TaqMan® PCR The following master mix should be used for all
PCR reactions, with 20 μl added to each well, 5
μl of sample DNA (i.e. 500 ng DNA) is added.
Constituent Vol/reaction
TaqMan® Universal Master Mix 12.5 μl
H2O 5 μl
Forward primer (10 μM) 2.25 μl
Reverse primer (10 μM) 2.25 μl
Probe (5 μM) 0.5 μl
DNA (100 ng/μL) 5 μl
Total volume 25 μl
Initial clone specific PCR and ALB PCR conditions are:
2 min at 50°C
10 min at 95°C
50 cycles of 15 sec at 95°C and 1 min at 60°C
Sensitivity and specificity testing
The clone specific primers must be tested for
efficiency and specificity before using to analyze
patient specimens. An acceptable primer must
reach a sensitivity of 10–4 and not have significant
reaction with pooled normal DNA control (NAC).
Method 1. Amplify the 10–2 dilution point of the
leukemic (target) DNA in duplicate and 6
NAC (normal mononuclear cell DNA)
control wells. Use 500 ng DNA per well
2. Examine Ct of 10–2 point. For an efficient
primer the Ct should be less than 30
3. Examine Ct of NAC. Ideally this should 50, or
at least 11 greater than Ct of 10–2 if sensitivity
of 10–4 is to be achieved
4. Choose the primer that best fits these 2
criteria. If none fit the first, then primer
redesign is required
5. If none fit the second, then incremental
increases in the annealing temperature can be
attempted (63, 66, and 69°C recommended)
6. If these steps do not result in a primer that fits
the criteria, then that particular rearrange-
ment is not suitable as an MRD marker
Real-time PCR applications in hematology 295
7. The sensitivity of a primer/probe combination
is defined as the lowest dilution point that has
a Ct value at least 3 less than that for NAC for
TCR δ, IgΚ and TCR γ or at least 6 less for IgH.
See below for definitions of sensitivity
Reproducible sensitivity Lowest dilution of standard curve with
reproducible Ct values (Ct values that differ by
less than 1.5) that is at least 3 less than that for
the NAC (at least 6 for IgH)
Maximal sensitivity The lowest dilution of standard curve giving
specific but non-reproducible Ct values, which
differ at least 1.5 Ct from Ct value of previous
10-fold dilution or NAC
Quantitation of MRD in remission specimens
1. Adjust DNA concentration to 100 ng/μl in TE
2. The patient’s dilution series is used as
standard curve for MRD measurement
3. The dilution series of pooled normal mononu-
clear cell DNA is used as standard curve for
control gene for quantity and quality of test
DNA
4. The clone specific forward primer, germline
reverse primer and probe are used to amplify;
the patient’s leukemic dilution series in dupli-
cate (the 10–6 is usually not included as such
sensitivity is not achieved); duplicate NAC
(pooled normal) 500 ng DNA per well; dupli-
cate NTC controls; the test sample in tripli-
cate with 500 ng DNA per well
5. The control PCR is used to amplify; normal
control dilution series in duplicate; duplicate
NTC; duplicate test samples
Both assays can be performed on same plate
unless the clone specific PCR assay requires an
increased annealing temperature as control gene
assays may not work at higher temperatures. See
Figure 16.4 for plate set-up
6. Perform 50 cycles of PCR and analyze the data
7. The slope of the clone specific standard curves
should be in the range –3.3 to –4.0. The corre-
lation coefficient of curves >0.95. The
maximum Ct variation between replicates of a
point <1.5. This defines the reproducible range
296 Real-time PCR
1 2 3 4 5 6 7 8 9 10 11 12
-1 -1 Test Test Test 0 0 -1 -1 Test Test Test
A L10 L10 C10 C10 L10 L10
1 1 1 1 1 1
-2 -2 -1 -1 -2 -2
B L10 L10 Test2 Test2 Test2 C10 C10 L10 L10 Test2 Test2 Test2
-3 -3 Test Test Test -2 -2 -3 -3 Test Test Test
C L10 L10 C10 C10 L10 L10
3 3 3 3 3 3
-4 -4 -3 -3 -4 -4
D L10 L10 C10 C10 L10 L10
-5 -5 -5 -5
E L10 L10 NTC NTC L10 L10
Test Test
F NAC NAC NAC NAC
1 1
G NAC NAC Test2 Test2 NAC NAC
Test Test
H NTC NTC NTC NTC
3 3
Columns 1–5 and 8–12 are the clone specific PCR experiments, columns 6 + 7 the
ALBUMIN control.
KEY: each well contains 500 ng of DNA except NTC which contain TE
L10 = leukemic dilution series
C10 = normal DNA dilution series
Test = test samples
NAC = normal mononuclear control DNA
NTC = no template control
Adapted with permission of Dr J. Hancock, University of Bristol
Figure 16.4
Clone specific TaqMan® MRD plate set-up for 2 markers.
8. Curves that do not fit these criteria are not
acceptable, as they will result in inaccurate
MRD quantitation
9. DNA concentration (and amplifiability) of the
test samples should be determined from the
control gene results. If the test sample DNA is
within the range 400–600 ng, the MRD result
should not be adjusted; however values
between 250–400 ng should be adjusted. If test
samples give a value significantly lower than the
supposed quantity of DNA put into the control
PCR, inhibition is the likely cause. Inhibition may
be overcome by using BSA in the PCR master
mix (Moppett et al., 2003) (a 2% w/v solution is
prepared, filter sterilized through a 0.2 μm filter
and 5 μl is used in each 25 μl master mix)
10. Quantitative results should be reported: if the
replicates are with 1.5 Ct and within the
reproducible range of the assay; if at 2/3 wells
Real-time PCR applications in hematology 297
have a reproducible Ct below the maximal
sensitivity of the assay. If both of these condi-
tions are satisfied the results calculated from
the standard curve should be reported
11. Positive but unquantifiable results are reported
if; there are non-reproducible Ct values outside
reproducible range but outside range of NAC;
if at least 2/3 wells have a reproducible Ct
above the maximal sensitivity but outside the
range of NAC. Report the data as <10–X
(where X = lower limit of reproducible range)
12. Report as not detected: if Ct values are 50; if
Ct values are within the range of NAC
Monitoring post-stem cell transplantation chimerism
The monitoring of patients who have undergone
allogeneic stem cell transplantation has relied on
semi-quantitative methods, such as short tandem
repeat (STR) PCR with fluorescent primers or
Southern blotting. Real-time PCR based on the
detection of single nucleotide polymorphisms has
been developed in some centers and is under
evaluation, however encouraging results are
emerging and sensitivities of 0.1–0.01% may be
possible (Maas et al., 2003).
Use of Y chromosome sequences
Male patients with female donors can be monitored
using Y chromosome specific assays (Fehse et al.,
2001), these are highly sensitive (0.001%) and
there may always be a threshold of positive cells,
therefore serial analysis is more useful, with any
increase in the level of male cells being regarded as
suspicious. Investigation of mixed chimerism should
always be done in tandem with MRD analysis where
suitable disease markers are available. Our labora-
tory uses an in-house assay based on detection of
the TSPY repeats on Y chromosome. The use of a
reiterated target makes this assay very sensitive; due
to the variation in number of TSPY repeats in
individual males, the ΔΔCt method is used.
Although this is not an expression assay, the values
obtained are sufficiently accurate to reflect fluctua-
tion in the level of male cells against a female
background. The control gene used is HBB, but
other genomic sequences may be used. Pre-trans-
plant DNA or buccal swab DNA from the recipient
is used as the calibrator sample.
298 Real-time PCR
Protocol 16.2: Use of
TSPY repeats on
Y-chromosome in
chimerism studies
REAGENTS AND CONSUMABLES
Optical Adhesive Cover (Applied Biosystems)
96-well real-time PCR plate (Applied Biosystems)
1.5 mL amber tubes (Axygen)
Aerosol-resistant pipette tips (Axygen)
Universal TaqMan® Master Mix (Applied Biosystems)
Molecular Biology Grade Sterile H2O
Oligonucleotide Primers (10 μM in molecular biology grade H2O)
TaqMan® probes (5 μM in molecular biology grade H2O, in amber tubes)
Primers and probes for TSPY PCR
TSPY 1139-F 5’ TGT CCT GCA TGT TGG CAG AGA
TSPY 1204-R 5’ TCA AAA AGA TGC CCC AAA CG
TSPY 1162-T
TaqMan® Probe 5’ JOE-CCT TGG TGA TGC CGA GCC GC-3’TAMRA
Beta globin 509-F 5’ CTG GCT CAC CTG GAC AAC CT
Beta globin 587-R 5’ CAG GAT CCA CGT GCA GCT T
Beta globin 541-T
TaqMan® Probe 5’ FAM-TGC CAC ACT GAG TGA GCT GCA CTG TG-3’
TAMRA
EQUIPMENT
7500 real-time PCR instrument (Applied Biosystems)
Genespec 1 micro spectrophotometer (Hitachi)
Centrifuge with microplate adapters
Micropipettes
METHOD
1. Purified DNA is the preferred template
material; however this assay can be performed
using white blood cells isolated by red cell lysis
techniques or ficoll gradient separation
Real-time PCR applications in hematology 299
2. Prepare master mixes for TSPY and HBB (or
preferred control gene). Set up triplicate
reactions for both. Remember that each male
patient requires his own individual calibrator
specimen. If possible, include a known female
DNA isolated at the same time as the test
specimens (NAC) and NTC
Constituent Vol./reaction TSPY Vol./reaction HBB
TaqMan® Universal Master Mix 12.5 μL 12.5 μL
H2O 3.5 μl 5.0 μl
Forward primer (10 μM) 0.75 μl 0.75 μl
Reverse primer (10 μM) 2.25 μl 0.75 μl
Probe (5 μM) 1.0 μl 1.0 μl
DNA (100 ng/μL) 5 μL 5 μL
3. Dispense 20 μL of mix to appropriate wells of
a 96-well plate (use adjacent sets of columns)
4. Add 5 μL of the test specimens, NAC and
NTC controls, before adding the pre-
transplant calibrator specimens
5. Seal the plate carefully with an optical
adhesive cover
6. Spin briefly
7. Set up the real-time instrument as per
manufacturer’s instructions. Use the default
Applied Biosystems thermal cycling protocol
of 95°C for 10 min followed by 50 cycles of
15 sec at 95°C and 60 sec at 60°C
8. Save the data and export the raw Ct data to
Microsoft Excel
9. Open the data in Excel. Sort by specimen and
detector and compare the replicate values.
Discard outliers and calculate the mean Ct for
each set of triplicates
10. Calculate the ΔCt for each specimen thus:
ΔCt = Mean Ct (TSPY) – Mean Ct (HBB)
11. Calculate the ΔΔCt for each test specimen
thus:
ΔΔCt = ΔCt Test – ΔCt Calibrator
12. Calculate the relative TSPY copy number
using the formula 2−ΔΔCt
13. The sensitivity of this assay is such that low
level TSPY sequences will be detected post
stem cell transplant (assuming sufficient DNA
is analyzed) in patients with complete donor
chimerism. This is probably due to contami-
nation with male cells during sampling.
300 Real-time PCR
Use of TSPY to monitor chimerism by real-time PCR
1.00E +00
1.00E –01
1.00E –02
1.00E –03
TSPY
1.00E –04
1.00E –05
1.00E –06
1.00W –07
0.00 5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00
Weeks post-transplant
Figure 16.5
Use of TSPY to monitor chimerism by real-time PCR.
However, it is more important to establish a
threshold for each patient. Increasing levels
should be investigated where possible with
MRD specific assays, the underlying disease
should be considered; acute leukemia
patients may have at least a tenfold higher
level in bone marrow compared to peripheral
blood if the TSPY level is an indicator of MRD
Serial analysis of peripheral blood from a young
male patient transplanted for high risk ALL is
shown in Figure 16.5; he became MRD positive at
fifteen weeks post-transplant and relapsed
clinically at week 48.
Real-time PCR for
prenatal diagnosis of
monogenic diseases
17
caused by single
nucleotide changes – the
example of the
hemoglobinopathies
Joanne Traeger-Synodinos, Christina Vrettou and
Emmanuel Kanavakis
17.1 Introduction to prenatal diagnosis (PND) in clinical
genetics
In developed countries, genetically determined disorders account for up to
one third of admissions to pediatric wards and are a significant cause of
childhood deaths. Although the Human Genome Project and related
advances in molecular biology promise means for the long-term curative
treatment of many severe genetic disorders, the current approach for
controlling these disorders remains prevention, including the application
of prenatal diagnosis (PND), recognized as an important reproductive
option.
PND aims to provide an accurate, rapid result as early in pregnancy as possi-
ble. A prerequisite involves obtaining fetal material promptly and safely, and
current methods include trophoblast sampling (also known as chorionic villi
sampling or CVS) or amniocentesis. Fetal cells and free fetal DNA are also
present in the circulation of the pregnant mother and provide a potential
source for ‘non-invasive’ fetal sampling, but reliable protocols have yet to be
established for clinical application (Hahn and Holzgreve, 2002). Termination
of affected pregnancies is the major disadvantage of PND, and there is still an
on-going debate about its ethical and social implications.
Preimplantation genetic diagnosis (PGD) represents a ‘state-of-the-art’
procedure which potentially avoids the need to terminate affected preg-
nancies through identification and transfer of only unaffected embryos
established from in-vitro fertilization (IVF) (Handyside et al., 1990).
302 Real-time PCR
Although there are several technical, practical, and ethical issues associated
with performing PGD, the procedure is progressively being incorporated
within the available option of clinical services for preventive genetics, and
is considered particularly appropriate for couples with an unsuccessful
reproductive history (Kanavakis and Traeger-Synodinos, 2002; Traeger-
Synodinos et al., 2003; Sermon et al., 2004).
17.2 Classic mutation detection methods for prenatal
diagnosis of monogenic diseases and best practice
guidelines
17.2.1 Classic mutation detection methods
The hemoglobinopathies were the first genetic diseases to be characterized at
the molecular level and have been used as a prototype for the development
of almost every new technique of mutation detection for more than 20 years.
Consequently there are numerous PCR-based techniques described in the
literature that can be used for PND of the globin gene mutations. The most
commonly used techniques include: allele specific oligonucleotide (ASO)
hybridization or dot blot analysis, reverse dot blot analysis, the amplification
refractory mutation system (ARMS), denaturing gradient gel electrophoresis
(DGGE), gap PCR, restriction fragment length polymorphism (RFLP) analysis
and direct DNA sequencing (Old et al., 2000; Kanavakis et al., 1997). Each
technique has its relative advantages and disadvantages in terms of simplic-
ity, speed, and cost. The choice of techniques used by any laboratory will be
influenced by the infrastructure and expertise available in the laboratory, the
budget, the sample throughput, and the spectrum of mutations in the target
population. In any laboratory providing PND, it is recommended that at
least two alternative methods are available for validating each mutation in
every prenatal sample.
Without doubt, the provision of PND requires the highest standards in
laboratory practice to minimize sources of potential errors and ensure an
accurate result. Based on more than two decades of experience, a general
consensus has been reached on the precautionary measures to minimize
risk of diagnostic errors (Old et al., 2000; Traeger-Synodinos et al., 2002).
17.2.2 Best practice guidelines for prenatal diagnosis
Best practice guidelines, which are applicable to PCR-based prenatal genetic
testing for any monogenic disorder, include:
1. To divide the original CVS or amniotic fluid samples to two aliquots, so
the fetal DNA can be analyzed in duplicate. In addition when CVS is the
source of fetal genetic material, to perform careful microscopic dissec-
tion (see below in the protocols for preparation of fetal samples in 17.5).
2. To obtain fresh parental blood samples along with the fetal sample in
order to confirm parental mutations and also as a source of control
DNA.
3. To analyze parental DNA samples and other appropriate controls for
the relevant disease-causing mutations alongside the fetal DNA.
Real-time PCR for prenatal diagnosis of monogenic diseases 303
4. To repeat the fetal DNA analysis to double check the result, ideally by
using a second independent method.
5. To exclude presence of contaminating maternal DNA in the fetal
sample through analysis of appropriate hypervariable genetic markers
(e.g. microsatellite loci) in the parental and fetal DNA; the fetal DNA
should demonstrate inheritance of one maternal and one paternal
allele for any loci tested.
6. Finally, the PND report should detail the methods of DNA analysis used
and state the risk of misdiagnosis based on the literature and the audit
results of the diagnostic laboratory.
17.3 Sources of fetal samples for prenatal diagnosis
The aim of PND is to provide a result as early in the pregnancy as possible,
and thus it is preferable if the fetal sample is obtained within the first
trimester by CVS sampling between 10–12 weeks of pregnancy. The alter-
native is to obtain an amniocentesis sample from about 14–16 weeks of
pregnancy. Overall CVS samples provide more DNA and are less prone to
co-sampling of maternal cells, which can lead to contamination of the fetal
DNA.
The yield of DNA extracted from a trophoblast sample weighing around
20–25 mg is typically 30–40 μg. DNA can be prepared from amniotic fluid
cells directly or after culturing. The quantity of DNA extracted directly from
15 ml of non-cultivated amniotic fluid cells (~5 μg) is sufficient for PND
based on PCR methods in most cases.
The risk of contamination with maternal DNA can be ruled out in most
cases by the presence of one maternal and one paternal allele following the
amplification of ‘informative’ polymorphic repeat markers, as mentioned
above in the best practice guidelines.
The analysis of single-cells within the context of PGD involves a different
procedure in that the single-cell is simply lysed in the eppendorf tube in
which the cell was initially placed. This releases the cellular DNA content
and the reagents for the initial processing are added directly to the tube;
these are usually for the first-round PCR reaction, although some protocols
start with whole genome amplification or multiple displacement amplifica-
tion. A protocol for lysing single cell samples is outlined within the proto-
col described for single-cell genotype analysis (see ‘Cell Lysis’ in 17.5).
17.4 Real-time PCR protocols for PND and PGD applied to
the hemoglobinopathies: background and design of
protocols
17.4.1 Real-time PCR and allele discrimination using the
LightCycler® (system 1.0 or 1.5)
Real-time PCR integrates microvolume rapid-cycle PCR with fluorometry,
allowing real time fluorescent monitoring of the amplification reaction for
quantitative PCR and/or characterization of PCR products for rapid
genotyping, precluding any post-PCR sample manipulation. The
LightCycler® (Roche Molecular Biochemicals) is one such system. The detec-
304 Real-time PCR
tion of potential sequence differences for genotyping applications (usually
Single Nucleotide Polymorphisms, SNPs) employs the use of two fluorescent
probes which hybridize to adjacent internal sequences within target ampli-
fied DNA, one of which covers the region expected to contain the
mutation(s). Close proximity of annealed probes facilitates fluorescence
resonance energy transfer (FRET) between them. The probes are designed to
have different melting temperatures (Tm) whereby one with the lower Tm
spans the mutation site(s). Monitoring of the emitted fluorescent signals as
the temperature increases will detect loss of fluorescence (F) as the lower Tm
probe melts off the template. A single base mismatch under this probe
results in a Tm shift of 5–10°C, allowing easy distinction between wild-type
and mutant alleles. The ability to detect base mismatches under the low Tm
probe (mutation detection probe) and the use of two different colored
probes (LightCycler® system 1.0 or 1.5) allows more than one mutation to
be screened in a single PCR reaction.
17.4.2 Molecular basis of β-hemoglobinopathies
The β-globin gene is a relatively small gene (<2000 bp) located in the short
arm of chromosome 11. Although more than 180 causative mutations have
been reported for β-thalassemia syndromes (http://www.globin.cse.psu.
edu), in any given population, there are a limited number of common
mutations and a slightly larger number of rare mutations. The majority of
common mutations tend to cluster within neighboring gene regions, and
this facilitates the use of a small number of probe sets for mutation detec-
tion.
17.4.3 Principles behind design of LightCycler® probe sets and
assays in the β-globin gene (appropriate for Systems 1.0 and 1.5)
All the allele-specific probes were designed to be complementary for the
wild-type sequence, allowing the detection of any sequence variation
compared to normal under the region of probe-hybridization (Vrettou et al.,
2003). This precluded the need to use multiple independent assays using
separate mutation-specific detection probes. This potentially allows the
distinction of any allele with a nucleotide variation located under the
length of the probe, minimizing costs and time required to screen a large
spectrum of mutations, as is necessary for most populations where β-
thalassemia is common. Although most mutations have a distinct melting
profile and can be detected by comparison with controls, the definitive
characterization of each mutation can be achieved by a second method
such as an ARMS-PCR assay (Old et al., 1990). As stated in the best practice
guidelines, any laboratory performing DNA diagnostics should have more
than one available mutation detection method.
The protocol that we designed for the Greek population, which is also
suitable for most other populations, where the β-hemoglobinopathies are
prevalent, uses just four combinations (or sets) of probes for mutation
detection, on two alternative PCR amplicons (Figure 17.1). The LightCycler®
PCR primers (sets LC1 and LC2) were designed with the aid of computer
software (Amplify version 2.0, Bill Engels, 1992–1995) to amplify two
Real-time PCR for prenatal diagnosis of monogenic diseases 305
Set1F
Set1F Set1R
Set1R
LC1F
LC 1F LC1R
LC 1R
Set A Set C
Ac+20
Ac+2 0 AcCd5.6.8
AcCd5.6.8 AcIVS1-110
AcIVS 1-110 AcCd39
AcCd39
EXON 1 INTRON 1 EXON 2
AcIVS-1.5.6
AcIVS- 1.5.6 AcIVS2-1
AcIVS 2-1
Set B Set D
Set2F
Set2F Set2R
Set2R
LC2F
LC 2F LC2R
LC 2R
: : Set 1 primers and nested LightCycler® primers (LC1)
: : Set 2 primers and nested LightCycler® primers (LC2)
: Allele-specific acceptor probes
:: Donor probes
Figure 17.1
The position of the β-globin gene primers and LightCycler® hybridization probe
sets appropriate for prenatal diagnosis and preimplantation genetic diagnosis
protocols. The primers illustrated include two alternative sets for use in the first-
round of PCR relevant only for single cell genotyping (Set 1 or Set 2) and two
alternative sets of primers for use in the real-time PCR genotyping assay on the
LightCycler® (sets LC1 or LC2). F = forward primer; R = reverse primer.
alternative regions of the β-globin gene surrounding the majority of the
most common β-thalassemia mutations in all world populations, along
with the HbS mutation (Table 17.1 and Figure 17.1).
Design of LightCycler® mutation detection probe sets took into account
secondary structure properties (e.g. hairpin-loops) and potential primer-
dimer formation between the probes themselves and the PCR primers,
evaluated by computation prior to synthesis (TIB MOLBIOL, Berlin,
Germany). In addition, design of mutation detection probes avoided the
regions of the β-globin gene known to contain common sequence variants
such as codon 2 (CAC>CAT). The LightCycler® systems 1.0 and 1.5 can
detect 2 fluorescent labels (LightCycler® Red 640 [LC Red 640] and
LightCycler® Red 705 [LC Red 705]) as well as SYBR® Green. The choice of
fluorescent label for each probe will depend upon the relative frequency of
mutations in the population under study and the potential requirement for
multiplexed assays when more than one mutation is investigated within a
306 Real-time PCR
Table 17.1 LightCycler® mutation detection probe sets
Beta-gene Probe set Acceptor probe name Donor probe name
mutation and sequence and sequence
CAP +20 (C>T)* Set A Ac +20: Donor set A:
CAP+22 (G>A) 5’-tc tga cac aac tgt gtt cac FITC 5’ cct caa aca gac
tag ca 3’ LC Red** acc atg gtg cac c-3’ FITC
HbS (Cd 6 A>T) Ac Cd5.6.8:
Cd5 (-CT) LC Red** 5’ gac tcc tga gga
Cd6 (-A) gaa gtc tgc-3’ P***
Cd8 (-AA)
Cd 8/9 (+G)
IVSI-1 (G>A) Set B Ac IVSI-1.5.6: Donor set B:
IVSI-1 (G>T) LC Red** 5’ tgt aac ctt gat acc 5’ tgc cca gtt tct att ggt ctc ctt
IVSI-2 (T>G) aac ctg ccc a-3’ P*** aaa cct gtc-3’ FITC
IVSI-2 (T>C)
IVSI-2 (T>A)
IVSI-5 (G>A)
IVSI-5 (G>C)
IVSI-5 (G>T)
IVSI-6 (T>C)
IVSI-110 (G>A) Set C Ac IVSI-110: Donor set C:
IVSI-116 (T>G) 5’-tct gcc tat tgg tct att ttc FITC 5’-ccc tta ggc tgc tgg tgg
cc-3’ LC Red** tc-3’ FITC
Cd39 (C>T) Ac Cd39:
Cd37 (TGG>TGA) LC Red** 5’-acc ctt gga ccc
Cd41/42 (delTTCT) aga ggt tct t-3’ P***
IVSII-1(G>A) Set D AcIVS2–1: Donor set D:
LC Red** 5’ gtc cca tag act cac cct gaa g-3’
5’ tct cag gat cca cgt gca FITC
gct tg-3’ P***
The LightCycler® PCR reactions also include a set of (b-globin gene specific PCR primers, either set LC1 or set
LC2. LC1 Forward (F): 5’-GCT GTC ATC ACT TAG ACC TCA-3’; LC1 Reverse®: 5’-CAC AGT GCA GCT CAC TCA
G-3’; LC2 Forward (F) 5’-CAA CTG TGT TCA CTA GCA AC-3’; LC2 Reverse® 5’-AAA CGA TCC TGA GAC TTC
CA-3’.
FITC: Fluorescein.
* = Polymorphism linked with the IVSII-745 (C>G) mutation.
** = LC Red: The fluorescent label used for each probe will depend upon the relative frequency of mutations
in the population under study and the potential requirement of multiplexed assays (Red640 or Red705).
***P= Phosphorylated.
single sample. For example in the Greek population, IVSI-110 G>A is the
most common mutation, so the probes for most other mutations encoun-
tered in Greece are labeled with the opposite fluorescent marker to that
used for IVSI-110 G>A.
More specifically, two of the probe combinations (named set A and set C)
include 2 acceptor (mutation detection) probes with one central donor
probe (Figure 17.1) foreseeing the use of one or both acceptor probes of the
set according to the needs of any genotyping assay. Each of the acceptor
probes in sets A and C are labeled with different acceptor fluorophores and
the central donor probe, designed to span the distance between the two
acceptor probes, is labeled with a fluorescein (F) molecule at both 5’ and 3’
ends. Set B was designed to screen for several neighboring mutations with
Real-time PCR for prenatal diagnosis of monogenic diseases 307
use of a single mutation detection (acceptor) probe and D was designed to
detect a single mutation, each in combination with a donor probe which is
labeled with fluorescein only at the end adjacent to the acceptor probe
(Table 17.1, Figure 17.1). In all sets the mutation-screening (acceptor) probes
were designed to have a lower Tm relative to the donor probes, thereby
ensuring that the fluorescent signal generated during the melting curve, is
determined only by the mutation probe.
17.4.4 Additional considerations in design of single-cell
genotyping for PGD using real-time PCR
In clinical PGD, the diagnosis has to be achieved on a single cell, with only
one initial PCR reaction possible. In addition, the result has to be available
within 24 hours. PCR-based diagnosis of single-cells is susceptible to PCR
failure, allele drop-out (when one of the alleles fails to amplify to detectable
levels) and contamination. PCR failure means no result, which is undesir-
able, but allele drop-out and contamination are dangerous as they can lead
to an unacceptable misdiagnosis. Thus PCR protocols have to be optimized
to minimize PCR failure and allele drop-out, and contamination must be
stringently avoided and ideally monitored in each individual sample (by
the parallel analysis of hypervariable microsatellite loci) to preclude mis-
diagnosis. Finally when confronting a relatively common monogenic
disorder such as the β-thalassemias and hemoglobinopathies, ideally the
method should be flexible to facilitate detection of a wide spectrum of
disease-associated mutation-interactions, precluding the design and
standardization of case-dependant protocols each time.
Thus the overall strategy we designed (Vrettou et al., 2004) involved a
first-round multiplex PCR (approximate time 1.5 h), containing β-globin
gene first-round PCR primers (Set1 or Set2) for the amplification of a region
of the β-globin gene surrounding the case-specific mutations along with
fluorescently-labeled primers for amplification of two polymorphic
microsatellite markers GABRB3 (at the GABAA receptor b3 locus in the
Angelman/Prader–Willi region on chromosome 15) and D13S314 (Table
17.2). The first-round multiplex PCR was followed by: 1) real-time nested
PCR with hybridization probes for analysis of β-globin gene alleles (approx-
imate time 40 min), and in parallel, 2) size analysis of the two microsatellite
markers on an automatic sequencer (approximate time 35 min) for
monitoring and precluding contamination. Genomic DNA from the
parents in each cycle was amplified in parallel along with blank samples
from the IVF unit and PCR premix blanks.
17.4.5 Potential advantages of real-time PCR protocols for PND
and PGD
Advantages of real-time PCR protocols for PND
The ability to carry out rapid DNA analysis for genotype characterization
has become an increasingly important requirement for the clinical diagnos-
tic laboratory. A wide variety of methods exist for detecting point
mutations in a DNA molecule, including ASO, PCR-RFLP, ARMS, DGGE,
308 Real-time PCR
Table 17.2 Sequences of primers included in the first-round multiplex PCR
for PGD protocol
Primers Sequence of primers Product size, bp
β gene
Set 1*
F 5’-GAA GTC CAA CTC CTA AGC CA-3’
(70373–70393)**
R 5’-CAT CAA GGG TCC CAT AGA CTC-3’ 689
(71041–71062)**
β gene
Set 2*
F 5’-CAA CTG TGT TCA CTA GCA AC-3’
(70560–70580)**
R 5’-TAA AAG AAA CTA GAA CGA TCC-3’ 637
(71176–71197)**
GABRB3
F 5’-CTC TTG TTC CTG TTG CTT TCA ATA CAC -3’
R*** 5’-CAC TGT GCT AGT AGA TTC AGC TC -3’ 191–201
D13S314
F*** 5’-GAG TGG AGG AGG AGA AAA GA-3’
R 5’-GTG TGA CTG GAT GGA TGT GA-3’ 137–155
* For amplifying the β-globin gene, include either Set1 or Set2 in first-round multiplex
PCR, with subsequent use of either LC1 primers or LC2 primers (as appropriate) for
mutation analysis on the LightCycler® (see Figure 17.1).
** Co-ordinates of primers based on GenBank NG_000007.
*** 5’ fluorescently labeled with Cy5.5.
F: forward primer.
R: reverse primer.
and direct sequencing. However, these methods require several hours and
sometimes days to complete a diagnosis, and, consequently, there is a need
for more rapid, high-throughput assays.
When applied for PND, the LightCycler® real-time PCR method is very
rapid and accurate. Once the parental mutations are known, PND requires
less than 3 hours for completion, including the stage of DNA extraction
from the fetal sample. The distribution of mutations means that many cases
require only one PCR reaction (including two LightCycler® mutation detec-
tion probe sets if necessary), minimizing both the time and cost of the PND
procedure. Furthermore, in cases where the two parental mutations differ
but are under the same detection probe, the melting curve of a normal allele
is always distinguished when present, thus preventing a misdiagnosis.
Advantages of real-time PCR protocols for PGD
The sensitivity of real-time PCR is expected to maximize the detection of
amplified DNA copies, even when present in low numbers. This potentially
reduces the frequency of amplification failure and allele drop-out.
Furthermore, even if allele drop-out does occur, it is monitored by the use of
the nested real-time PCR, which will detect both alleles contributing to the
Real-time PCR for prenatal diagnosis of monogenic diseases 309
genotype. Embryos with ‘impossible’ genotypes are considered to have allele
drop-out and are not recommended for transfer. Only those embryos in
which a normal allele is definitely detected are recommended for transfer.
The protocol as designed for the β-hemoglobinopathies is capable of
detecting a wide range of mutations and genotype interactions simply
through selecting the appropriate β-globin gene primers and LightCycler®
hybridization probe(s) (Table 17.1 and Figure 17.1). This is an important
consideration when offering PGD for a common disease with a wide
spectrum of mutation interactions, as it precludes the need to standardize
case-specific protocols each time a new couple requires PGD.
The incorporation of real-time PCR into the PGD protocol means that the
entire procedure for genotype analysis is very rapid, requiring less than 6
hours for completion, and well within the 24–hour time limit between
blastomere biopsy and embryo transfer.
References
Hahn S, Holzgreve W (2002) Prenatal diagnosis using fetal cells and cell-free fetal
DNA in maternal blood: what is currently feasible? Clin Obstet Gynecol 45:
649–656.
Handyside AH, Kontogianni EH, Hardy K, Winston RM (1990) Pregnancies from
biopsied human preimplantation embryos sexed by Y-specific DNA amplifica-
tion. Nature 344: 769–770.
Kanavakis E, Traeger-Synodinos J, Vrettou C, Maragoudaki E, Tzetis M, Kattamis C
(1997) Prenatal diagnosis of the thalassemia syndromes by rapid DNA analytical
methods. Mol Hum Reprod 3: 523–528.
Kanavakis E, Traeger-Synodinos J (2002) Preimplantation Genetic Diagnosis in
Clinical Practice. J Med Genet 39: 6–11.
Old J, Petrou M, Varnavides L, Layton M, Modell B (2000) Accuracy of prenatal
diagnosis for haemoglobin disorders in the UK: 25 years’ experience. Prenat
Diagn 20: 986–991.
Old JM, Varawalla NY, Weatherall DJ (1990) Rapid detection and prenatal diagnosis
of beta-thalassaemia: studies in Indian and Cypriot populations in the UK.
Lancet 336: 834–837.
Sermon K, Van Steirteghem A, Liebaers I (2004) Preimplantation genetic diagnosis.
Lancet 363: 1633–1641.
Traeger-Synodinos J, Vrettou C, Palmer G, Tzetis M, Mastrominas M, Davies S,
Kanavakis E (2003) An evaluation of PGD in clinical genetic services through 3
years application for prevention of beta-thalassemia major and sickle cell
thalassemia. Mol Hum Reprod 5: 301–307.
Traeger-Synodinos J, Old JM, Petrou M, Galanello R (2002) Best practice guidelines
for carrier identification and prenatal diagnosis of haemoglobinopathies.
European Molecular Genetics Quality Network (EMQN). CMGC and EMQN,
http://www.emqn.org
Vrettou C, Traeger-Synodinos J, Tzetis M, Malamis G, Kanavakis E (2003) Rapid
screening of multiple β-globin gene mutations by real time PCR (LightCycler™):
application to carrier screening and prenatal diagnosis for thalassemia
syndromes. Clin Chem 49: 769–776.
Vrettou C, Traeger-Synodinos J, Tzetis M, Palmer G, Sofocleous C, Kanavakis E (2004)
Real-time PCR for single-cell genotyping in sickle cell and thalassemia
syndromes as a rapid, accurate, reliable and widely applicable protocol for
preimplantation genetic diagnosis. Hum Mutat 23: 513–521.
310 Real-time PCR
Protocol 17.1: Cleaning
chorionic villi (CVS) by
microscopic dissection
The CVS sample is usually sent from the gynecology clinic in a universal vial
in 10–15 ml of saline or culture medium. Sometimes small pieces of
maternal tissue are co-biopsied with the villi, and other times a considerable
amount of maternal blood is also present in the vial along with the CVS.
The villi have a distinct, white frond-like appearance, as opposed to the
reddish-pink amorphous appearance of other tissues, which in most cases
can be distinguished visually. It is essential that any maternal tissue present
in the sample is removed, as the presence of maternal tissue may result in a
diagnostic error. There should be enough tissue from most CVS samples for
two separate aliquots to allow analysis in duplicate.
Equipment and reagents
1. Bench centrifuge appropriate for eppendorf
centrifugation around 3000 g
2. Eppendorf tubes (sterile and DNase/RNase
free, 1.5 ml)
3. Sterilized fine forceps
4. Sterile Petri dishes
5. Disposable pipettes
6. Dissecting microscope with ×10
magnification
7. Sterile saline solution (0.9% NaCl)
Method 1. Take two Eppendorf tubes, label clearly and
add 200 μl of saline solution to each
2. Pour the contents of the universal vial into a
sterile Petri dish, taking care that no tissue
remains on the walls of the universal tube
3. Rinse the universal vial with about 5–10 ml
saline or culture medium and add to the
sample already in the Petri dish
4. Place the Petri dish on a dissecting
microscope and remove any maternal tissue
adhering to the villi using small clean fine
forceps (or two sterile needles)
5. Using forceps place pieces of villi into the
two Eppendorf tubes, taking care that the
villi do not stick to the forceps (’stirring’ the
Real-time PCR for prenatal diagnosis of monogenic diseases 311
forceps in the saline solution in the tubes
facilitates their release)
6. Once all the villi have been placed into the
Eppendorf tubes, close the lids of the tubes
(discard the contents of the Petri dish as for
any biological sample)
7. Spin the CVS samples at approximately
3000 g in a centrifuge suitable for
Eppendorf tubes
8. Carefully tip off the supernatant, wash the
villi again with 200 μl of saline solution and
again discard the supernatant
The villi are now ready for DNA extraction
312 Real-time PCR
Protocol 17.2:
Centrifugation of
amniotic fluid cell
samples to collect
amniocytes
The gynecology clinic usually sends approximately 10–15 ml of amniotic
fluid sample in a Universal vial. Some laboratories recommend that an
aliquot be set up as a backup culture, because occasionally a direct
amniotic fluid sample fails to provide sufficient DNA to achieve a diagnosis,
or as a source of DNA if maternal contamination is indicated in the direct
sample. However, in our laboratory in Athens we do not set up amniocyte
cultures as we have rarely failed to achieve a complete prenatal analysis
when applying PCR methods, although on rare occasions we have had to
request a new amniocentesis sample due to evidence of maternal
contamination.
Equipment and reagents
1. Centrifuge appropriate for 10–15 ml tubes
and centrifugation at around 3000 g
2. Sterile centrifuge tubes, 10–15 ml capacity
3. Eppendorf tubes (sterile and DNase/RNase
free, 1.5 ml) and an appropriate centrifuge
for centrifugation around 3000 g
4. Sterile Petri dishes
5. Disposable pipettes
6. Saline solution (0.9% NaCl), sterile
Method 1. Distribute the amniotic fluid sample equally
between two separate sterile 10–15 ml
centrifuge tubes
2. Spin the samples at approximately 3,000 g
to pellet the cells and carefully remove the
supernatant
3. Resuspend each pellet in approximately 0.5
ml of saline solution and using a pipette
transfer to sterile clearly labeled 1.5 ml
eppendorf tubes
4. Repeat step 2
Real-time PCR for prenatal diagnosis of monogenic diseases 313
5. Wash the pellet once more with 0.5 ml of
saline solution and repeat step 4
The amniocytes are now ready for DNA
extraction.
314 Real-time PCR
Protocol 17.3: DNA
extraction from chorionic
villi samples or
amniocytes using
commercially available
DNA purification
columns
The kit that we use in the laboratory in Athens is the QIAMP DNA mini kit
(Qiagen, Hilden, Germany) and we follow the ‘Blood and Body Fluid Spin
Protocol’.
1. Resuspend the washed, pelleted villi or
amniocytes in 200 μl of saline solution
2. Add 20 μl of proteinase K solution, as
described in the directions in the kit
3. Follow the remaining steps exactly as
described in the ‘Blood and Body Fluid Spin
Protocol’
Note: If amniotic fluid cell samples produce a
pellet that is only just visible after the cells are
initially harvested then use half the volume of
elution buffer for the final elution step (100 μl
versus 200 μl)
Real-time PCR for prenatal diagnosis of monogenic diseases 315
Protocol 17.4: Protocol
for rapidly screening
multiple b-globin gene
mutations by Real-Time
PCR: application to
carrier screening and
prenatal diagnosis of
thalassemia syndromes
The method described is based on our publication (Vrettou et al., 2003)
and even without modification is suitable for detecting the majority of the
most common β-globin gene mutations worldwide.
Equipment and reagents
1. LightCycler® system version 1.0 or 1.5
(Roche)
2. Bench centrifuge for Eppendorf tubes (with
well depth approximately 4.5 cm) and
appropriate for centrifugation around
3,000g
3. 32 centrifuge adapters in aluminium cooling
Block, LightCycler® Centrifuge Adapters
(Roche, 1 909 312)
4. LightCycler® glass capillary tubes (20 μl),
(Roche, 11 909 339 001)
5. Filter tips for maximum volume of 20 μl and
200 μl along with compatible accurate
adjustable pipettes
6. Eppendorf tubes for making the premix
7. A pair of PCR primers selected according to
mutations under study (either LC1F plus
LC1R or LC2F plus LC2R as shown in Table
17.1 and Figure 17.1)
8. Mutation detection probe sets, appropriate
316 Real-time PCR
for mutations under study (see Table 17.1
and Figure 17.1)
9. LightCycler® -D NA Master Hybridization
probes Kit (Roche, 2 015 102), which also
includes MgCl2 (25 mM) and PCR-grade
water
PCR set-up 1. In an Eppendorf tube make a premix for the
amplification reactions for a total reaction
volume of 20 μL/sample. Each reaction
should contain the ready-to-use reaction
mix provided by the manufacturer
(LightCycler® DNA Master Hybridization
Probes) plus MgCl2, a β-globin gene PCR
primer pair and LightCycler® fluorescent
probe sets for the relevant mutations. A
typical PCR reaction for single color
detection for one sample is shown in Table
17.3
2. When calculating the premix volume, make
premix enough for the number of samples
being genotyped, a PCR premix blank plus
controls for the mutation(s) under
investigation. The controls should include a
homozygous wild-type sample (N/N), a
sample heterozygous for the mutation
Table 17.3 A typical PCR reaction for single color detection for one sample
Stock Final μl/sample
Conc* Conc*
H2O (PCR grade) 9.6 μl
MgCl2 25 mM 4 mM 2.4 μl
Beta globin forward primer
LC1(F) or LC2(F) 10 μM 0.5 μM 1 μl
Beta globin reverse primer
LC1® or LC2® 10 μM 0.5 μM 1 μl
LC Red allele-specific
probe (640 or 705) 3 μM 0.15 μM 1 μl
FITC donor 3 μM 0.15 μM 1 μl
Master mix 2 μl
Premix volume 18 μl
DNA sample volume 2 μl
Total reaction volume 20 μl
Conc* = concentration.
The volume of water is always adjusted to give final reaction volume of 20 μl/sample even
when more than one probe set is included in the reaction. For example a PCR reaction
with dual color detection using 2 allele-specific LC probes (one labeled with Red 640 and
the other with Red 705) and a common (central) doubly labeled FITC probe, or even two
sets of LC donor-acceptor probes (i.e. 4 probes).
Real-time PCR for prenatal diagnosis of monogenic diseases 317
(M/N) and a sample homozygous for the
mutation (M/M)
3. Place the appropriate number of
LightCycler® glass capillary tubes in the
centrifuge adapters in an aluminum-cooling
block
4. Distribute accurately 18 μl of premix in all
the capillaries
5. Add 2 μl genomic DNA (approximately 50
ng) per sample and controls and 2 μl of
double-distilled water to the PCR blank
6. Once the PCR reactions have been set up in
the capillaries at 4°C place the caps carefully
on each capillary without pressing down yet
7. Remove the capillaries (in their aluminium
centrifuge adaptors) from the cooling block
and place in a bench centrifuge
8. Spin gently at 300 g for 20 sec to pull the
20 μl reaction volume to the base of the
glass capillary
9. Place the glass capillaries carefully into the
LightCycler® carousel and simultaneously
gently press the cap fully into the capillary
and the glass capillary fully down in place in
the LightCycler® carousel
10. Place carousel in the LightCycler® and
initiate the PCR cycles and melting curve
protocols using the LightCycler® software
version 3.5.1
Amplification and melting curve analysis
1. Preprogram the LightCycler® software for
the following amplification steps: a first
denaturation step of 30 sec at 95°C
followed by 35 cycles of 95°C for 3 sec,
58°C for 5 sec and 72°C for 20 sec with a
temperature ramp of 20°C/s. During the
PCR, emitted fluorescence can be measured
at the end of the annealing step of each
amplification cycle to monitor amplification
2. Immediately after the amplification step, the
LightCycler® is programmed to perform
melting curve analysis to determine the
genotypes. This involves a momentary rise
of temperature to 95°C, cooling to 45°C for
2 min to achieve maximum probe
hybridization, and then heating to 85°C
with a rate of 0.4°C/s during which time
the melting curve is recorded
318 Real-time PCR
3. Emitted fluorescence is measured
continuously (by both channels F2 (640 nm)
and F3 (705 nm) if necessary) to monitor
the dissociation of the fluorophore-labeled
detection probes from the complementary
single-stranded DNA (F/T) (F: Fluorescence
emitted, T: Temperature). The computer
software automatically converts and displays
the first negative derivative of fluorescence
to temperature vs. temperature (–dF/dT vs.
T) and the resulting melting peaks allows
easy discrimination between wild-type and
mutant alleles (Figure 17.2)
Real-time PCR for prenatal diagnosis of monogenic diseases 319
0.28
0.26
0.24
0.22
0.20
Fluorescence –d(F2)/dT
0.18
0.16
0.14
0.12
0.10
0.08
0.06
0.04
0.02
0.00
–0.02
46.0 48.0 50.0 52.0 54.0 56.0 58.0 60.0 62.0 64.0 66.0 68.0 70.0 72.0 74.0 76.0 78.0 80.0 82.0 84.0
Temperature (°C)
0.085
0.080
0.075
0.070
0.065
Fluorescence –d(F3)/dT
0.060
0.055
0.050
0.045
0.040
0.035
0.030
0.025
0.020
0.015
0.010
0.005
0.000
55.0 56.0 58.0 60.0 62.0 64.0 66.0 68.0 70.0 72.0 74.0 76.0 78.0 80.0 82.0 84.0 85.0
Temperature (°C)
Figure 17.2
Examples of melting curves for two common β thalassemia mutations.
A. Analysis of samples for the IVSI-110 G>A mutation using hybridization probe
Set C with the Ac IVS1–110 and the donor probe set C. B. Analysis of samples
for the IVSI-1 G>A mutation using hybridization probe Set B with the Ac IVS-
1.5.6 and the donor probe set B. In both examples, as for all hybridization
probe sets we describe (Vrettou et al., 2003), the right-shifted single peak
represents the melting curve for normal (wild-type) sequences in the region of
hybridization. Any mutation under the region where the allele-specific acceptor
probe hybridizes will cause a reduced melting temperature and thus the melting
curves for homozygous mutant samples will be left-shifted. The samples
heterozygous for a wild-type and mutant allele give a double-peaked melting
curve.
320 Real-time PCR
Protocol 17.5: Real-time
PCR protocols for single-
cell genotyping and PGD
PGD is a multi-step procedure combining expertise both in reproductive
medicine and genetic diagnosis. PGD includes embryo biopsy, cell lysis and
genotype analysis. For all PGD cycles, precautions against contamination
have to be most stringent at all stages. Manipulation of cells and PCR set-up
are carried out in separate UV-treated laminar flow hoods. PCR set-up
employs dedicated PCR pipettes and pipette tips with filter. In the first round
PCR, negative (blank) controls include 2 tubes containing IVF medium and 2
tubes with cell lysis mixture (prepared alongside cell biopsies in the IVF unit),
and 1 tube containing PCR mixture alone (prepared in genetics laboratory
during PCR set-up). To exclude contamination within the system all negative
controls from the first round PCR should be analyzed for the presence of
amplified hypervariable microsatellite loci (see below), and additionally
subjected to nested PCR analysis in the LightCycler®. It is recommended that
one-use disposable gloves, gowns and even face masks are worn by all
operators during cell manipulation and PCR set-up.
The protocol described below focuses on the stages of genotype analysis
of single cells with the use of real-time PCR.
Equipment for cell lysis and first PCR
1. Dedicated UV-treated laminar flow hood for
PCR set-up, and separate laboratory space
post-PCR manipulations
2. Filter tips for maximum volume of 20 μl
and 200 μl, along with compatible accurate
adjustable pipettes (UV treat before each
PGD PCR set-up)
3. 200 μl Eppendorf tubes for first round PCR
for the parental DNA samples and premix
blank. (This size of Eppendorf is also used
by IVF centers in which they place the
single cells from embryos biopsied)
4. 500 μl or 1.5 ml Eppendorf tubes for
making the premix for the first round PCR
5. 1.5 ml Eppendorf tubes for diluting the first-
round PCR reactions on the single-cells,
prior to LightCycler® PCR set-up
6. Thermal cycler with plate which holds
200 μl Eppendorf tubes
Real-time PCR for prenatal diagnosis of monogenic diseases 321
Reagents 1. PCR-grade water
2. PCR-grade solution Proteinase K (Roche, 03
115 887 001), diluted to 150 μg/ml and
stored at 20°C in single use aliquots
sufficient for a single PGD (average number
of embryo-biopsied samples of 10)
3. HotStarTaq® Master Mix (Qiagen, Hilden,
Germany)
4. MgCl2 (25 mM)
5. β-globin gene PCR first round PCR primer
pair (either Set1F with Set1R or Set2F with
Set2R, according to mutations under study,
as shown in Table 17.2 and Figure 17.1),
and two sets of primer pairs for amplifying
the microsatellites GABRB and D13S314 (see
Table 17.2) labeled with an appropriate
fluorophore for detection on the in-house
automatic sequencer; in the laboratory in
Athens we have a Visible Genetics
OpenGene™ System automatic DNA
sequencer which can detect Cy5.0 or Cy5.5
fluorescent labels
Cell lysis 1. At the IVF unit each single blastomere (from
a 3 day embryo) is placed directly into a
0.2 ml Eppendorf tube in 10 μl of sterile
double-distilled sterile water, overlaid with
mineral oil (all DNAse and RNase free) and
placed at 20°C for at least 30 min
2. Five μl of PCR-grade Proteinase K diluted in
sterile double-distilled water were added to
the 10 μl of water containing the selected
cell, to a final concentration of 50 μg/ml
3. On receipt of single-cell samples at the
genetics unit, the Proteinase K is activated
by incubation in a thermal cycler at 37°C
for 1 h followed by 65°C for 10 min, and
finally inactivated by heating to 95°C for 10
min. This treatment lyses the blastomeres
First-round multiplex PCR (to be set up in a UV-treated laminar flow
hood)
1. In an Eppendorf tube, make a premix for
the amplification reactions for a final
reaction volume of 50 μl/sample (taking
into account that the single cells have been
biopsied and lysed in a volume of 15 μl, i.e.
the premix volume for each sample is 35
μl). The contents of a typical single reaction
322 Real-time PCR
are shown in Table 17.4. Make premix
enough for all the embryo samples, the
blanks from the IVF unit, the parental DNA
samples, and the first-round premix blank
2. Distribute 35 μl of premix to the 15 μl of
the single-cell lysate (which is already in
200 μl Eppendorf tubes). Open the lid of
each embryo sample individually to add the
premix and change gloves in between to
prevent cross-contamination between
samples
3. For the parental DNA samples add an
additional 13 μl double-distilled sterile water
and 2 μl genomic DNA to make a final
volume of 50 μl, and to the first-round
premix blank add 15 μl double-distilled
sterile water. These reactions should also be
set up in 200 μl Eppendorf tubes and
overlaid with mineral oil
4. Immediately following PCR set-up, place the
Eppendorf tubes in a thermal cycler. PCR
cycling conditions are programmed to
include a long initial denaturation time (15
min at 94°C), to activate the hot-start Taq
polymerase enzyme (HotStar) and
additionally to ensure complete denaturation
of genomic template DNA, followed by 18
cycles of 96°C for 30 sec, 60°C for 40 sec,
and 72°C for 30 sec, and 18 additional
cycles of 96°C for 30 sec, 60°C for 20 sec,
and 72°C for 30 sec
Table 17.4 A typical first round multiplex PCR reaction for one cell for
single-cell genotyping.
Stock Final μl/sample
Conc* Conc*
HotStar Taq® Master Mix 30 μl
Beta globin forward primer:
Set 1 F or Set 2 F 100 μM 1 μM 0.5 μl
Beta globin reverse primer:
Set 1 R or Set 2 R 100 μM 1 μM 0.5 μl
D13S314 F 100 μM 0.4 μM 0.2 μl
D13S314 R 100 μM 0.4 μM 0.2 μl
GABRB3 F 100 μM 0.4 μM 0.2 μl
GABRB3 R 100 μM 0.4 μM 0.2 μl
MgCl2 25 mM 3.3 μM 3 μl
Premix volume 35 μl
Cell lysate volume 15 μl
Total reaction volume 50 μl
Conc* = concentration.
Real-time PCR for prenatal diagnosis of monogenic diseases 323
Protocol 17.6: Nested
PCR and genotyping of
b-globin gene using
Real-Time PCR in the
LightCycler®
Equipment and reagents
The equipment and reagents used for the
nested PCR real-time PCR for genotyping the β-
globin gene in single cells are identical to those
described in the section ‘Protocol for rapidly
screening multiple β-globin gene mutations by
real-time PCR: application to carrier screening
and PND of thalassemia syndromes.’ The only
additional requirement is double-distilled RNase
and DNase-free water in order to make the
dilutions of the first-round single cell PCR
reactions.
Diluting the first-round PCR reactions and PCR set-up
The nested PCR reactions from the single-cell
samples are carried out following the dilution of
the first-round PCR reactions to 1/106.
1. To make the dilutions, prepare 2 Eppendorf
tubes per cell sample, clearly numbered and
each containing 1 ml of double-distilled
water. Take a 1 μl aliquot of the first-round
PCR and add it to 1 ml of water, mix well,
centrifuge and the take a 1 μl aliquot of the
1/103 dilution and add to 1 ml of water,
mix well and centrifuge; the final 1/106
dilution is now ready for adding to the
nested real-time PCR reaction
2. Nested PCR amplification reactions for μ-
globin gene mutation analysis are carried
out in LightCycler® glass capillary tubes
using 2 μl of diluted aliquot from the first
324 Real-time PCR
round PCR amplification, in a total reaction
volume of 20 μl exactly as described in the
previous section, using PCR primers and the
appropriate combination of mutation
detection probes are selected according to
the parental genotypes (Table 17.1 and
Figure 17.1)
Real-time PCR for prenatal diagnosis of monogenic diseases 325
Protocol 17.7:
Monitoring of
contamination by sizing
GABRB3 and D13S314
polymorphic
microsatellites
The fluorescently (Cy5.0) tagged PCR-generated products of the
polymorphic dinucleotide repeat microsatellite markers GABRB3 and
D13S314 are generated in the multiplex first round of PCR. The amplicons
from the single-cells were sized without diluting the first round PCR
reaction; the PCR reactions from the parental DNA samples were diluted
approximately 1 to 20 prior to loading on the automatic sequencer. The
automatic DNA sequencer presently used in the Athens laboratory is the
Visible Genetics OpenGene™ System automatic DNA sequencer with Gene
Objects software (Visible Genetics, Evry, France), and each lab will have its
own automatic sequencer. Thus we will not describe the protocol or
equipment as these will be lab-specific.
The ranges of allele-sizes for each marker are noted in Table 17.2.
326 Real-time PCR
Protocol 17.8: Technical
tips and troubleshooting
when performing
Real-Time PCR and
genotyping using the
LightCycler® system 1.0
and 1.5
Handling and storage of PCR primers and probes
All PCR primers to be used on the LightCycler®
are diluted to 100 μM, divided into aliquots of
convenient volume (e.g. 25 μl) and are stored
at −20°C. The primer working solutions (10 μM)
are stored at 4°C for up to 3 months.
The LightCycler® hybridization probes are
diluted to 3 μM and stored in aliquots of
relatively small volume (e.g. 20 μl) at 20°C. A
thawed aliquot should not be refrozen, but can
be used up to 1 month when stored at 4°C.
Troubleshooting with melting curve analysis
Sometimes heterozygous samples do not give a
double peak following melting curve analysis,
although the single peak will lie between that of
the homozygous wild-type and homozygous
mutant samples. This problem tends to occur
when there is a relatively high number of
samples per run; the maximum number of
samples that can be analyzed in a single run
using the LightCycler® (system 1.0 and 1.5,
software version 3.5) is 32, but we have found
that a sample number above approximately 20
may lead to this result (see also Chapter 9 for a
discussion of the same problem).
Real-time PCR for prenatal diagnosis of monogenic diseases 327
The problem is due to the fact that the
temperature increment for the melting curve is
too high. During the LightCycler® melting curve
analysis the temperature increases form 45°C to
90°C, which requires about 150 sec when using
the ‘continuous acquisition’ mode and a
temperature increment of 0.3°C/sec. In
continuous acquisition mode the temperature
increases continuously, and does not take into
account that the measurement of fluorescence
between one capillary and the next takes a
certain time. If a small number of samples are
analyzed, the fluorescence of each will be read
more often during the 150 sec of melting curve
data acquisition compared to a run with more
samples. The result is that there are too few
measurement points in the latter situation to
calculate a detailed melting curve with two
distinct peaks when two alleles are present (as
in a heterozygote sample).
There are three possible solutions to this
problem:
1. For high sample numbers it is
recommended that the temperature
increment used for the melting curve is
decreased, e.g. to 0.1°C/sec when using
continuous acquisition mode, or to
0.4°C/sec when using stepwise acquisition
mode
2. If the melting curve still fails to give a
satisfactory result, although is not
recommended by the manufacturer, we
have found that additional melting curves
can be performed using other temperature
increments (it must be noted that the
quality of the melting curves is reduced
each time an analysis is performed)
3. In cases when the melting curve still fails to
give satisfactory result when more than
about 20 samples are analyzed, stop the
LightCycler® program following the
amplification step and perform melting
curve analyses in batches (including the
appropriate controls with each melting
curve analysis)
Index
3’ untranslated region (UTR), 4 BLAST, 99, 141, 173, 191
5’ nuclease, 6, 23, 191, 232, 235 Bovine serum albumin, 278
Absolute quantification, 58, 64, Calibration curve (see Standard
133, 193, 221, 280–282 curve)
Acceptor fluorescent dye Carrier DNA, 283
(quencher), 11, 22, 307 Chimerism (see Experimental
Allele drop-out, 307–309 protocol)
Allele-specific oligonucleotide Coefficient of determination (r2),
(ASO), 285, 287–288, 302, 307 39, 41
Allelic discrimination, 23, 25, Coefficient of variation (CV), 51,
151–152, 163–167, 188, 233, 57, 84, 118
246–247, 262–264, 301–327 Comparative Ct method (see
Amplicon size, 96, 131, 191, 208 Relative quantification)
Amplification curve (see Competitive RT-PCR, 2
Amplification plot) Contamination control, 284, 307,
Amplification efficiency, 9, 41–43, 325
52, 69–74, 103, 112–115, 134, Control gene (see Reference gene)
136, 143, 145, 194, 201, 202, Conversion of mass to molecule, 41
208, 281 Crossing point (Cp) (see Threshold
Amplification efficiency correction, cycle)
69, 115 Cycling conditions, 29
Amplification plot, 8, 9, 45–46, 48,
50, 56, 68, 103, 144, 300 Δ Rn (normalized fluorescence
Amplification view, 46–48, 56 value) (see Reporter signal)
Antimicrobial susceptibility testing, DABCYL, 21
223 DABSYL, 12, 20
Arithmetic mean, 89 Dark dyes, 14
Assay-sensitivity, 285 DART-PCR (see Software)
Assay-specific primers (see Reverse Data analysis and reporting, 39–62,
transcriptase reaction) 76, 133–135, 174–176, 213
Avogadro number, 41, 283 Dilution method, 70
Dissociation curve (see Melting
Background (see Baseline) curve)
Background control, 209 DNA isolation, 26, 197, 278
Baseline, 8, 39, 45, 47–50, 71, 114 DNA polymerase, 6, 7
BEST-KEEPER (see Software) DNase treatment, 26, 32, 55, 129,
Black hole quenchers (BHQ)™, 12, 149, 272–273, 279
56 Dominant negative effect, 185
330 Real-time PCR
Donor fluorescent dye (reporter), FAM creep, 53
11, 14, 22, 307 Fluorescence resonance energy
dsDNA binding dyes, 14, 17–18, 87, transfer (FRET), 11, 304
157–159, 164 Fluorescent signal, 8, 10, 232,
Duplex TaqMan®, 238 254–255
dUTP, 54, 284 Fluorimetry (see
Dynamic range, 2, 41, 205 Spectrophotometry)
Efficiency (see Amplification GAPDH, 67, 88, 90, 133, 150, 260,
efficiency) 281
Efficiency correction (see GC content, 93–94
Amplification efficiency Gene stability index, 121
correction) Genotyping (see Allelic
ELISA, 205–207 discrimination)
Endogenous control (see Reference Geometric mean, 89
genes) Gradient (see Slope)
Error induced trends approach, 89 Graphpad Prism®, 59
Ethidium bromide, 2
Exon boundary, 4, 26, 40, 55, 96, Hairpin primer, 19
131, 140–141, 150 Haploinsufficiency, 185
Experimental protocol: Heteroplasmy, 185, 193–194
allelic discrimination, 315–319, HEX, 14
323–324 High resolution melting analysis,
chimerism monitoring, 297, 155–169
298–300 Histone genes, 87
contamination control, 325 Homoplasmy, 185
immuno-PCR, 211–217 Hot-start enzyme, 6, 8, 17, 29, 36,
minimal residual disease 37, 321–322
monitoring, 290–297 House-keeping genes (see Reference
mitochondrial DNA analysis, genes)
191–201 Hybridization probes, 22, 25–26,
qPCR, 102–103, 127–137 236–239, 246–247, 305–306,
quantitative methylation 315–319
analysis, 179–182 Hydrolysis probes (see TaqMan®)
real-time immuno-PCR, 211–218
pathogen detection, 229–230, Immuno-PCR, 205–217
244–245, 246–247 Intercept, 39, 41, 42, 43, 51, 52, 55,
single-cell genotyping, 320–322 58, 194
viral load determination, Internal control, 239–240, 250
248–249 Intron-exon boundary (see Exon
Exponential phase, 8, 50, 71 boundary)
External control, 58, 221, 241
External standard (see External JOE, 14, 19
control)
Kinetic outlier detection, 76
False amplification, 53
False negative results, 220, 232, Laboratory precautions, 283–284
251–253 LATE-PCR, 10
False priming, 6, 8 LCGreen™ dyes, 18, 158
FAM, 11, 14–15, 18–19, 46, 53, 56 Linear phase, 8–10, 50, 71
Index 331
Linear scale, 50 Normalization, 65–66, 83–92,
LNA probes, 22, 24–25 116–118, 121, 260–261
Logarithmic scale, 50
LUX™, 12, 19 Oligo-dT primers (see Reverse
Lysis buffer, 197–198 transcriptase reaction)
One-step reaction, 27–28, 274–275
Magnesium chloride optimization, Optimization, 41, 44, 201, 209
201–202
MALDI mass spectrophotometry, Pairwise fixed reallocation
171, 172 randomization test, 77
Master mix, 27, 35, 36, 54, 56 Pathogen detection, 221–223
Mathematical models, 66–68 bacteria, 222–224
Melting curve analysis, 79, 102, fungi, 224–225
104, 140, 146–147, 151, parasites, 224–225
155–169, 190, 201, 221, viruses, 231, 237–239, 244–245,
236–239, 254–255, 256, 245–247, 264–265
317–319, 326–327 Pathogen quantification, 221–223
Melting temperature (Tm), 40, 94, PCR-dependent reference, 87
96, 99 PCR inhibitors, 68, 220, 250, 278
Melting temperature (Tm) Pharmacogenetics, 260–261
calculation, 94–95, 292 Pipetting, 28, 284
Methylation-specific PCR, 171–181 Plateau phase, 8, 10, 50, 71
Mfold (see Software) Plexor system, 20–21
Microsoft Excel®, 14, 41, 66, 77–79, Poly-A tails, 4, 87
115, 134 Positive control, 55
Minimal residual disease (MRD), Preimplantation genetic diagnosis,
285–289, 290–297 301
Minor groove binding (MGB) Premier Biosoft International, 105
probe, 22–23, 56, 233–234, Prenatal diagnosis, 301, 302
254–255 Primer3, 104
Mispriming, 94 PrimerBank, 97, 104
Mitochondrial DNA analysis, Primer design, 93–105, 131,
183–204 140–142, 173–174, 191–192,
Mitochondrial DNA diseases, 292
186–189 Primer dimer, 93, 96, 98, 99,
Molecular beacon, 22–24, 97, 105, 103–104, 146, 190, 208
167 Primer Express®, 96, 105, 131,
Monte Carlo effect, 57 140–141
Multicomponent view, 46–47, 49, Primer optimization, 142–143
53–54, 56–57 Probe-based assays, 21, 36, 93,
Multiplexing, 6, 15, 19–20, 22, 190, 164–165, 189–190
192, 225, 307–308, 321–322 Pseudogenes, 26, 65, 96, 191, 281
Mutation scanning, 155, 157, Pyrosequencing, 171, 172, 176, 181
159–162
Q-GENE (see Software)
Nearest neighborhood method, 95 QPPD, 104
No amplification control (NAC), Quantitative real-time PCR (qPCR),
35, 283–284, 294 3, 57–58, 83, 102–103,
No template control (NTC), 40, 44, 107–126, 127–137, 239–242,
52–53, 55, 209, 283–284 273–275
332 Real-time PCR
Quencher dye (see Acceptor chorionic villi, 310–311, 314
fluorescent dye) urine, 270
Sample-to-sample variation, 68
R0 method, 112 Scorpions, 19, 167
Random hexamer primers (see Secondary structure, 96, 99
Reverse transcriptase reaction) Set-up view, 46
Raw spectra view, 46, 49, 54, 56–57 Set-up sheet, 132, 209, 214, 296
Real-time PCR instruments, 12, Sigmoidal (logistic) curve fit, 72
15–17, 52, 208 Slope, 39, 41, 42, 43, 51, 55, 58, 70,
Real-time PCR primer set, 104 71–72, 77
Reference dye, 11, 12, 40, 54 SNP typing (see Allelic
Reference genes, 64–67, 88, discrimination)
116–117, 121, 133–135, 194, Software:
221, 260, 281, 292–293 BEST-KEEPER, 65,
Reference gene index, 58, 64, 65, DART-PCR, 59, 71, 79, 115
67, 77 Excel® (see Microsoft Excel®)
Relative quantification, 63–82, 107, geNORM, 65
112–115, 133, 142, 193, 221, LightCycler® relative expression
280 software, 69, 76, 77
ΔCt / ΔCp method, 64, 66 LinReg PCR, 71
ΔΔCt / ΔΔCp method, 65–66, Mfold, 9, 191
112–113, 133–135, 221, 280, qBase, 69, 78, 79
299 Q-GENE, 59, 69, 78
Reporter dye (see Donor fluorescent REST, 59, 69, 77–78
dye) SoFar, 69, 74, 79
Reporter signal, 40, 56 Rotor-Gene™ 3000 software, 69
Reverse transcriptase, 5, 35 Spectrophotometry, 86–87, 197
Reverse transcriptase reaction, 2–5, Spike, 2, 88, 238, 240
86–87, 101, 123, 130, 149, 279 Standard curve, 9, 28, 39, 41–42,
assay-specific primers, 4, 6, 8 49–52, 55, 57–59, 64, 113, 115,
oligo-dT primers, 4, 8, 95, 142, 142, 144–145, 194–196, 213,
279 280, 281, 286, 293
random hexamer primers, 4, 8, Statistical power, 118
95, 130, 142, 279 Stoke’s shift, 10, 11
–Reverse transcription control Strand asymmetry, 191
(–RTC), 35, 44, 55 SYBR® Green, 2, 11, 14, 16, 18, 19,
RNA integrity, 285 26, 29, 37, 46, 72, 96, 101–103,
RNA isolation, 26–27, 120, 127, 131, 139–154, 176, 190,
128–129, 149, 272–273, 279 192, 199, 229–230
RNA quantification, 86, 129
RNase protection assay, 2 TAMRA, 11
ROX, 12, 14, 46, 53, 57, 75 TaqMan®, 22–24, 39, 96, 140, 167,
ROX drop, 53 192, 224, 233–234, 236,
rRNA, 18S, 260–261, 281 248–249, 273–275, 286, 290,
RT Primer DB, 104 293–294, 298
Target gene index, 64
Sample processing: Threshold, 39, 45, 50–51, 75, 114
amniotic fluid cells, 312–313 Threshold cycle (Ct, Cp), 40, 46, 64,
biopsy, 270 75, 112
blood, 270 Tm (see Melting temperature)
Index 333
Transplant monitoring: Viral load determination, 231–232,
bone marrow transplantation, 239–242, 248–249, 257, 264
277–300
solid organ transplantation, Wallace rule (see Melting
259–278 temperature calculation)
Two-step reaction, 27–28, 35–37 Whole error approach, 89
Uracil n-glycolase (UNG), 54, 284