Papers by Nickolas Chelyapov
Thermal denaturation of DNP
Bulletin of Experimental Biology and Medicine
Autologous NK cells propagated and activated ex vivo decrease senescence markers in human PBMCs
Biochemistry and Biophysics Reports
Aging is a multifactorial process involving many steps including senescence. The immune system pl... more Aging is a multifactorial process involving many steps including senescence. The immune system plays a critical role in aging where chronic inflammation and senescence has been shown to be detrimental. Natural killer (NK) cells are the predominant innate lymphocyte subset that mediate various responses to include surveillance and elimination of senescent cells. Here, we use autologous propagated and activated NK (aNK) cells from 5 patients to demonstrate that aNK cells decrease senescent cells in vitro and immunosenescence in humans based on markers p16 and β-galactosidase. In addition, inflammatory cytokine panel data suggest a role for removal of immunosenescence to reduce the aging-related inflammatory response.
Analysis of disturbances in macromolecular organization of DNP induced by nitrogen mustard
Bulletin of Experimental Biology and Medicine, 1972
In the invest igat ion desc r ibed below, the effect of ni t rogen m u s t a r d i t se l f on th... more In the invest igat ion desc r ibed below, the effect of ni t rogen m u s t a r d i t se l f on the phys icochemiea l s ta te of DNP was studied. The act ion of this compound can be explained only by alkylat ion and the re is no p o s s i bil i ty of additional in te rac t ion between DNP and the phenylalanine radical . In addition, the fact that n i t rogen m u s t a r d does not absorb in the UV region essen t ia l ly faci l i ta tes the de terminat ion of the c h a r a c t e r of the changes of DNA-prote in in te rac t ion under the influence of the bifunctional alkylating mutagen.
Solution of a Satisability Problem on a Gel-Based DNA Computer
Abstract. We have succeeded in solving an instance of a 6-variable 11-clause 3-SAT problem on a g... more Abstract. We have succeeded in solving an instance of a 6-variable 11-clause 3-SAT problem on a gel-based DNA computer. Separations were performed using probes covalently bound to polyacrylamide gel. During the entire computation, DNA was retained within a single gel and moved via electrophoresis. The methods used appear to be readily automatable and should be suitable for problems of a signicantly larger size. 1
Recombinant HIV and modified packaging cells and method for treating acquired immune deficiency syndrome
Virology journal, Jan 19, 2005
Infection by human hepatitis C virus (HCV) is the principal cause of post-transfusion hepatitis a... more Infection by human hepatitis C virus (HCV) is the principal cause of post-transfusion hepatitis and chronic liver diseases worldwide. A reliable in vitro culture system for the isolation and analysis of this virus is not currently available, and, as a consequence, HCV pathogenesis is poorly understood. We report here the first robust in vitro system for the isolation and propagation of HCV from infected donor blood. This system involves infecting freshly prepared macrophages with HCV and then transmission of macrophage-adapted virus into freshly immortalized B-cells from human fetal cord blood. Using this system, newly isolated HCV have been replicated in vitro in continuous cultures for over 130 weeks. These isolates were also transmitted by cell-free methods into different cell types, including B-cells, T-cells and neuronal precursor cells. These secondarily infected cells also produced in vitro transmissible infectious virus. Replication of HCV-RNA was validated by RT-PCR analysi...
Replication of poxvirus DNA in chick embryo fibroblasts
Acta virologica, 1981
Replication of vaccinia virus DNA in chick embryo fibroblasts at a high multiplicity of infection... more Replication of vaccinia virus DNA in chick embryo fibroblasts at a high multiplicity of infection started after 4-6 hr, reached a maximum at the 12th hr and was completed 18 hr after inoculation (p.i.). An analysis of newly synthesised DNAs in the period of the highest rate of synthesis revealed the formation of short (10-30S) fragments which within 30 min were transformed into single-stranded molecules with a sedimentation coefficient of 62S. The final stage of closing of the ends of single-stranded molecules needed much more time and the bulk of "mature" single-stranded 90 S DNA molecules was observed 17 hr p.i.
Antigenic properties of vaccinia virus and of the virus recombinant strains expressing heterologous genes
Acta virologica, 1988
Immunologic properties of vaccinia virus (VV), strain LIPV, and VV recombinant strains containing... more Immunologic properties of vaccinia virus (VV), strain LIPV, and VV recombinant strains containing the gene of hepatitis B virus surface antigen and the TK gene of herpes simplex virus (HSV) have been studied. Production of antibodies against the majority of VV structural proteins, including nucleocapsid internal proteins was demonstrated in rabbits. Insertion of heterologous genes into the VV genome was without effect on the spectrum of antibodies produced against VV virion proteins. The data obtained in volunteers indicate that not only virus-neutralizing antibodies but also antibodies against most VV structural proteins are preserved in humans over many years. Reimmunization of volunteers with VV recombinant stimulates synthesis of antibodies against virion proteins whereas the spectrum of antibodies remains unchanged. Humans and rabbits did not differ in the spectrum of antibodies to VV virion proteins.
Biologic properties and genome structure of the recombinants between ectromelia and rabbitpox viruses
Acta virologica, 1987
Administration of rabbitpox virus (RPV) DNA, cleaved into 2 fragments by SmaI restrictase, into e... more Administration of rabbitpox virus (RPV) DNA, cleaved into 2 fragments by SmaI restrictase, into ectromelia virus (EMV)-infected chick fibroblast cells yielded recombinants whose properties were characteristic of both parents. Some recombinants capable of producing RPV-type lesions upon intracutaneous (i.c.) infection of rabbits could also produce EMV-specific lesions upon footpad inoculation of mice. The analysis of some recombinants as well as vaccinia virus strains has shown that the ability of the virus to reproduce when injected into the mouse footpad is a necessary, but not a sufficient condition for production of EMV-type lesions. According to restrictase analysis of recombinant DNA, the genome of recombinants mainly consists of RPV DNA sequences with insertions of small EMV DNA fragments.
Two vaccinia virus recombinants expressing HBsAg with different concentration of A- and pre-S2 antigenic determinants
Acta virologica, 1991
Comparative studies of two vaccinia virus (VV) recombinants expressing the hepatitis B virus (HBV... more Comparative studies of two vaccinia virus (VV) recombinants expressing the hepatitis B virus (HBV) surface antigen (HBsAg) including the pre-S2 region (M-protein) showed that the L-pre-S2/15 recombinant expressed 5-fold more HBsAg as determined by the content of a-determinant than the recombinant v137. However, both recombinants expressed comparable amounts of the pre-S2 antigenic determinant as assessed by enzyme immunoassay with monoclonal antibodies. According to our calculations, one HBsAg unit expressed by the recombinant v137 contained 7-9 times more pre-S2 antigen than did one HBsAg unit expressed by the L-pre-S2/15 recombinant. Binding of pre-S2 region to polymerized human serum albumin was shown not to be an efficient assay at low pre-S2 concentration. HBsAg expressed by the v137 recombinant was less extensively secreted from cells as compared to that expressed by L-pre-S2/15 recombinant. Both recombinants induced the production of antibodies to the pre-S2 antigenic determi...
Electrical wiring of polynucleotides for nanoelectronic applications
Science, 2002
A 20-variable instance of the NP-complete three-satisfiability (3-SAT) problem was solved on a si... more A 20-variable instance of the NP-complete three-satisfiability (3-SAT) problem was solved on a simple DNA computer. The unique answer was found after an exhaustive search of more than 1 million (2 20 ) possibilities. This computational problem may be the largest yet solved by nonelectronic means. Problems of this size appear to be beyond the normal range of unaided human computation.
Journal of the American Chemical Society, 2004
Type-a triangular complex black: ttcgtccagtgagcatcctgtagttgcggattcgtccagtgagcatcctgtagttgcggattcg... more Type-a triangular complex black: ttcgtccagtgagcatcctgtagttgcggattcgtccagtgagcatcctgtagttgcggattcgtccagt gagcatcctgtagttgcgga red: ggatagcgccatgctcactggacgaatccgcaactacaggaacgaacactcc purple: tgttcgttggcgct Type-b triangular complex black is the same as in type-a triangular complex green: gactgagcccatgctcactggacgaatccgcaactacaggaactactcatcc orange: atccggatgagtagttgggctcagtcggag Purple and orange sequences were derived from those found in
Journal of the American Chemical Society, 2005
Virologic, immunologic, and clinical evaluation of human immunodeficiency virus antibody status of symptom-free children born to infected mothers
The Journal of Pediatrics, 1994
To determine the prevalence of infection by the human immunodeficiency virus (HIV) in a populatio... more To determine the prevalence of infection by the human immunodeficiency virus (HIV) in a population of symptom-free children who were born to HIV-infected mothers and who subsequently underwent seroreversion from an HIV antibody-positive to an HIV antibody-negative status. Cohort. Pediatric HIV program in a community setting. We used HIV DNA polymerase chain reaction (PCR) and coculture to detect the presence or absence of HIV in peripheral blood mononuclear cells of 134 children aged 6 to 53 months. All children had HIV antibody at birth and underwent a subsequent seroreversion to antibody-negative status. In 134 children with HIV antibody-negative status, 219 of 220 culture results and 242 of 247 HIV-1 DNA PCR assay results were negative. Six positive laboratory results were obtained for six different children, each of whom had negative results on multiple assays. For HIV-infected children, 56 of 62 cultures and 99 of 104 PCR evaluations showed positive results. There was no clinical or laboratory evidence of HIV infection in the group with HIV antibody-negative status. We were unable to find evidence of latent HIV type 1 infection in this cohort of symptom-free children who underwent seroreversion to HIV antibody-negative status. The loss of maternal HIV antibody in these children indicates the absence of HIV infection. False-positive PCR and culture results occurred sporadically, indicating that repeated analysis of HIV seropositivity in infants and children is necessary.
Uploads
Papers by Nickolas Chelyapov