Published online January 29,
28, 2004
Nucleic Acids Research, 2004, Vol. 32, No. 2 e21
DOI: 10.1093/nar/gnh019
Selective DNA ampli®cation from complex genomes
using universal double-sided adapters
Matthew J. Callow, Snezana Drmanac and Radoje Drmanac*
Callida Genomics Inc., 675 Almanor Avenue, Sunnyvale, CA 94085, USA
Received October 16, 2003; Revised and Accepted December 11, 2003
ABSTRACT targeted genomic DNA fragments generated by restriction
endonucleases that cut outside of their recognition sequence
There is a rapidly developing need for new technolo- (Type IIs) (1). Sequence speci®city is achieved by assembling
gies to amplify millions of different targets from two oligonucleotides into double-sided adapters for a ligation
genomic DNA for high throughput genotyping and mediated selection process.
population gene-sequencing from diverse species. The use of Type IIs restriction endonucleases to fragment
Here we describe a novel approach for the speci®c DNA, and the capture of those fragments by ligation to
Downloaded from http://nar.oxfordjournals.org/ by guest on August 16, 2015
selection and ampli®cation of genomic DNA frag- adapters, has been described in the past (2,3). These studies
ments of interest that eliminates the need for costly also relied upon the incorporation of primer binding sites in
and time consuming synthesis and testing of poten- the adapters to amplify the captured sequences over other
tially millions of amplicon-speci®c primers. This sequences by standard PCR methodologies. Type II enzymes
technique relies upon Type IIs restriction enzyme have also been applied to this goal (4); however, we are
digestion of genomic DNA and ligation of unaware of any studies that have demonstrated the isolation of
the fragments to double-sided adapters to form speci®c, pre-de®ned fragments from the human genome when
digested into millions of fragments. Sibson et al. (5) also
closed-circular DNA molecules. The novel use of
recently described an approach for sorting or indexing of Type
double-sided adapters, assembled through the
IIs restriction fragments using successive rounds of digestion
combinatorial use of two small universal sets of and ligation to adapters with two overhanging bases. This was
oligonucleotide building blocks, provides greater achieved by incorporating Type IIs restriction sites into the
selection capacity by utilizing both sides of the adapter to cut into the adjacent genomic sequence. In all, six
adapter in a sequence-speci®c ligation event. As bases were used to achieve a maximal possible enrichment of
demonstrated, formation of circular structures 1920-fold. The incorporation of Type IIs recognition
results in protection of the desired molecules from sequences into adapters for cutting into adjacent sequences
nuclease treatment and enables a level of selectivity (6) has also been applied in the technique of Serial Analysis of
high enough to isolate single, or multiple, pre- Gene Expression (SAGE) (7).
de®ned fragments from the human genome when There are several methodologies available that can reduce
digested at over ®ve million sites. Priming sites in- the complexity of genomes including AFLP (8), Alu-PCR
corporated into the adapter allows the utilization of (9,10), DOP-PCR (11±13) and PCR amplicon size selection
(14,15). These techniques are limited however, because they
a common pair of primers for the ampli®cation of
typically select from only a portion of the genome or they co-
any adapter-captured DNA fragment of interest.
isolate many undesired fragments. In the methodology we
present here, the entire genome is accessible and single,
speci®c DNA fragments can be isolated rapidly. Further
INTRODUCTION rounds of isolation with alternative techniques may enable the
The quest to isolate speci®c DNA fragments from complex selection of single fragments from complex genomes but this
genomes has centered around two major approaches. In the adds considerably to the complexity of the methods and
®rst, genomic fragments are captured during library construc- multiplexing cannot typically be performed without the
tion with subsequent clone isolation using sequence-speci®c associated isolation of many unwanted fragments.
probes. In the second, sequence-speci®c oligonucleotide Alternatively, the user is limited in some way to utilize only
primers are used in a DNA ampli®cation reaction. Existing sequences that fall within regions of the genome that are
approaches for selective ampli®cation from genomic DNA speci®cally targeted by the technology such as speci®c
have, therefore, often relied upon the custom generation of restriction enzyme fragments or size ranges. DOP-PCR and
reagents (primers and/or probes) speci®c for each polymorph- Alu-PCR can amplify random regions of the genome and
ism, which can be costly and time consuming. In this study therefore reduce sequence complexity but they have yet to be
we describe an approach for isolating single, or multiple, able to isolate speci®c sequences from complex genomes
*To whom correspondence should be addressed. Tel: +1 408 746 4525; Fax: +1 408 746 4596; Email:
[email protected]
Present address:
Matthew J. Callow, Perlegen Sciences, 2021 Stierlin Ct, Mountain View, CA 94043, USA
Nucleic Acids Research, Vol. 32 No. 2 ã Oxford University Press 2004; all rights reserved
e21 Nucleic Acids Research, 2004, Vol. 32, No. 2 PAGE 2 OF 6
without unwanted fragments and a universal oligonucleotide adapter core with 14 and 17 base 3¢ overhangs. Two shorter,
set. The methodology we report here is a rapid alternative to variable oligonucleotides were then ligated to the core with T4
these methods for the reduction of genome complexity and for DNA ligase (20 U/ml) (NEB) at 25°C to produce the 4-base 5¢
the single or multiplexed isolation of speci®c DNA fragments. overhangs. The ®nal concentration of variable oligonucle-
Our method, termed Universal Selective Ampli®cation, otides to core adapter was 8 mM each to 4 mM, respectively.
utilizes double-sided adapters to induce selective closed-circle The ®nal adapter was then phosphorylated and puri®ed using a
formation with target DNA, and exonuclease treatment to Qiaquick spin protocol (Qiagen, Valencia, CA). The DNA was
enhance selection and speci®city, especially critical for collected in 40 ml of 10 mM Tris/0.1 mM EDTA pH 8 (TE).
multiplex ampli®cation. Our approach for Universal
Selective Ampli®cation is designed for the combinatorial Adapter formation test
use of a relatively small and ®nite number of universal
adapter-building oligonucleotides for speci®c fragment selec- Core adapter, adapter after ligation of overhang oligonucle-
tion from millions of short genomic fragments. Furthermore, otides and adapter after ®nal phosphorylation was treated with
by utilizing common PCR primers, this technique will be more 2.5 U of Lambda Exonuclease (Roche, Indianapolis, IN) in a
amenable to applications requiring multiplex ampli®cation of reaction buffer of 67 mM glycine±KOH, pH 9.4, 2.5 mM
DNA sequences. MgCl2 and 50 mg/ml BSA in 10 ml. The reaction was incubated
There are two broad application areas for this methodology. at 37°C for 10 min and then at 75°C for 10 min.
The ®rst area utilizes and allows for the selection of multiple
Downloaded from http://nar.oxfordjournals.org/ by guest on August 16, 2015
fragments that share a particular fragment overhang-type, such First-round selection
as for sequence complexity reduction in which a speci®c Adapter (20 fmol) was ligated to 150 ng of BbvI-digested
fragment is enriched. The second area utilizes and requires a genomic DNA in a volume of 10 ml for 30 min at 25°C in the
higher level of selection for isolation of single, speci®c presence of 13 T4 DNA ligase buffer (NEB) and 200 U of T4
fragments or multiple speci®c fragments in a multiplexed DNA ligase (NEB). The enzyme was heat inactivated at 65°C
selection process. Applications of the methodology include for 10 min. The ligation reaction was then treated with 1 U of
detection and isolation of speci®c exons, genotyping of SNPs Bal31 nuclease (NEB) in the presence of 13 Bal31 nuclease
in a low sequence-complexity sample, and isolation of speci®c buffer (NEB) for 30 min at 30°C and then heat inactivated at
genes or regulatory elements. We present the successful 75°C for 10 min. The sample was diluted 10-fold with TE and
ampli®cation of three Escherichia coli and four human 8 ml were digested with 2.5 U of NotI enzyme (NEB) in a 10 ml
amplicons demonstrating the feasibility of the method. volume before 1 ml was used in a 30 ml PCR. PCR from
Adapter A was carried out at 94°C for 3 min, denaturation at
94°C for 20 min, annealing at 66 to 62°C for ®ve cycles and
MATERIALS AND METHODS 62°C for the following 35 cycles for 30 s. Extension was at
Oligonucleotides 72°C for 30 s. Reaction conditions were 13 Thermopol buffer
(NEB), 200 mM dNTP, 0.2 mM primers (5¢-TGAGACCAC-
Oligonucleotides were purchased from Qiagen-Operon AGCCTAGACAGC and 5¢-CTGCAAGGCGATTAAGT-
(Alameda, CA) and were HPLC puri®ed for lengths >40 TGG) and 0.6 U/100 ml Vent exo-DNA polymerase (NEB)
bases and 2-step HPLC puri®ed for lengths >60 bases. All or 1.8 U/100 ml Taq (Qiagen) in 10 mM Tris±HCl pH 8.3,
other oligonucleotides were supplied de-salted. In some cases 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin. If two rounds of
oligonucleotides were ordered phosphorylated from the selection were to be performed the NotI digest was omitted
manufacturer or were phosphorylated with T4 polynucleotide and the combined volume of the PCRs was 200 ml.
kinase (PNK) [New England Biolabs (NEB), Beverly, MA] by
incubating at 37°C for 30 min and then 65°C for 20 min.
Second-round selection
Reaction conditions were 10 U of PNK, 1 mM ATP, 13 PNK
buffer (NEB) and 250 pmol of 5¢ termini in a 20 ml reaction. The ®rst round PCR (200 ml) was puri®ed using the Qiaquick
protocol (Qiagen) and isolated in 40 ml of TE. Digestion of the
Genomic DNA digestion adapter was performed in a 10 ml reaction with 8 ml of puri®ed
Escherichia coli genomic DNA was sourced from the PCR, 13 NEB buffer 2 and 4 U of FokI enzyme (NEB).
MG1655 strain supplied from the American Type Culture Digestion was for 60 min at 37°C followed by inactivation at
Collection (Manassas, VA). DNA was isolated by lysis of 65°C for 20 min. The digest (8 ml) was then combined with
bacterial cells in an SDS±proteinase K solution followed by 103 T4 DNA ligase buffer (1 ml) adapter B (20 fmol, 1 ml) and
RNAse treatment and multiple phenol/chloroform extractions 200 U of T4 DNA ligase. After incubation for 30 min at 25°C
before ethanol precipitation (16). Human genomic DNA was and inactivation at 65°C for 10 min the reaction was digested
purchased from Promega (Madison, WI). The DNA (10 mg) with 1 U of Bal31 nuclease in 13 Bal buffer (NEB). The
was digested with 8 U of the restriction enzyme BbvI (NEB) sample was diluted 10-fold with TE and 8 ml were digested
for 3 h at 37°C before heat inactivation at 65°C for 20 min. with 2.5 U of NotI enzyme (NEB) in a 10 ml volume before 1 ml
was used in a 30 ml PCR at 94°C for 3 min, 94°C for 20 s,
Adapter preparation 58°C for 30 s, 72°C for 30 s over 35 cycles. Reaction
Adapters were prepared either by annealing two complete conditions were 13 Thermopol buffer (NEB), 200 mM dNTP,
single-stranded oligonucleotides to produce 4-base, 5¢ over- 0.2 mM adapter B primers (5¢-GACGGCTGAAATTGGTA-
hangs at each end or by annealing two complementary AGG and 5¢-CGGAATCAAAGCAGGATAAGG) and
oligonucleotides that, when double stranded, produce an 0.6 U/100 ml Vent exo-DNA polymerase (NEB).
PAGE 3 OF 6 Nucleic Acids Research, 2004, Vol. 32, No. 2 e21
RESULTS
Universal Selective Ampli®cation process
We selected Type IIs restriction enzymes that produce 4-base,
5¢ overhangs of digested genomic DNA to fragment the
genome into an estimated 32 768 (non-directional) variants
de®ned by the sequence of the overhangs. A double-sided
adapter preparation was used to capture speci®c fragments
into closed-circular molecules that protect the fragments from
subsequent exonuclease digestion (Fig. 1). For isolation of
single fragments from complex mammalian genomes, a
second round of selection was used by incorporating Type
IIs recognition sites into the adapter that cut further into the
genomic sequence of the captured fragment. The released
fragment was re-captured with a new adapter and ampli®ed by
PCR utilizing common primer binding sites in the adapter.
This two-step process predicts a theoretical 109-fold enrich-
ment of the desired fragment resulting in a speci®c, pre-
Downloaded from http://nar.oxfordjournals.org/ by guest on August 16, 2015
de®ned fragment being isolated from human genomic DNA
digested to 100 million fragments (one cut every 30 bases).
Adapter assembly
Although adapters could be prepared from as few as two sets Figure 1. Schematic representation of Universal Selective Ampli®cation
of 256 oligonucleotides that can form all possible 32 768 from the human genome. (1) Digestion of DNA with Type IIs restriction
complementary adapters, for this study adapters were prepared enzyme and ligation to adapter. The desired fragment (red) has overhangs
using a common phosphorylated core sequence with two complementary to the adapter. (2) Multiple structures are formed in a
ligation reaction, but the desired fragment is captured into a closed circular
different (one on each side) 14 to 17 base 3¢ overhangs. Two molecule. (3) Digestion of linear molecules and mismatch structures with
shorter, variable, 5¢ overhang-generating oligonucleotides, exonuclease preserves and enriches the circular molecules for PCR
each matching to one 14±17 base overhang were then ligated ampli®cation. (4) Digestion with a second Type IIs restriction enzyme
to the core DNA and the ®nal product was phosphorylated. To (recognition sites in yellow) releases the genomic insert and presents new
4-base overhangs. (5) A new adapter complementary to the new overhangs
con®rm that adapter assembly was occurring ef®ciently at is introduced and the process (ligation, exonuclease digestion and PCR) is
each stage, we developed a nuclease-sensitivity based assay repeated. For selective ampli®cation from the E.coli genome only the ®rst
by utilizing lambda exonuclease to degrade one strand of a three steps are used.
double stranded structure from the 5¢ phosphorylated end.
Non-phosphorylated ends are resistant to lambda exonuclease
degradation. Core adapter sequences were degraded by
exonuclease treatment, however after ligation of the 5¢
overhang oligonucleotides, most of the adapter was protected
from degradation suggesting ef®cient ligation of the overhang
oligonucleotides was occurring (Fig. 2). Final phosphorylation
of the adapter resulted in degradation of the adapter after
lambda exonuclease treatment demonstrating ®nal phos-
phorylation of the adapter was also occurring ef®ciently.
Figure 2. Gel analysis of the effects of lambda exonuclease treatment on
Escherichia coli genomic fragment isolation adapter assembly. Lanes 1 and 6, phosphorylated core adapter without
overhang oligonucleotides; lanes 2 and 7, Adapter 1 without phosphoryl-
The isolation of speci®c fragments from a complex mixture of ation; lanes 3 and 8, Adapter 1 with phosphorylation; lanes 4 and 9,
fragments was ®rst tested on the 4.6 Mb E.coli genome which, Adapter 2 without phosphorylation; lanes 5 and 10, Adapter 2 with phos-
when digested with BbvI, produces an estimated 18 000 DNA phorylation; lanes 1±5, without lambda exonuclease treatment; lanes 6±10,
with lambda exonuclease treatment; lane 11, 50 bp DNA marker (Promega).
fragments with variable 4-base, 5¢ overhangs. Three fragments DNA (1.25 pmol) was loaded onto 3% agarose gels and stained with
were selected of 100, 150 and 200 bp in size from three Gelstar stain (Cambrex).
random regions of the published genome and adapters were
designed and prepared for ligation with the digested genomic
DNA (Table 1). During the ligation process undesirable events
are also likely to be occurring such as inter- and intra-fragment captured in closed circles. This was performed either directly
ligation, ligation of an adapter to just one end of DNA from the circular target or on a target digested with NotI, to
fragments and free adapter remaining un-ligated. To eliminate linearize the circular molecule. All three selected fragments
these structures the ligation mix was treated with Bal31 were successfully ampli®ed from E.coli genomic DNA when
nuclease to destroy all linear molecules but preserve circular single adapters were included in the ligation (Fig. 3). Each
molecules. PCR using primer binding sites in the adapter and adapter selects for 1 of 32 768 fragment variants and so with
DNA polymerase was then used to amplify all fragments 18 000 fragments generated from the E.coli genome the
e21 Nucleic Acids Research, 2004, Vol. 32, No. 2 PAGE 4 OF 6
Table 1. Enzyme recognition and cleavage sites for genomic fragments selected from the E.coli and human genomic sequences
Genomic fragment Location Left ¯anking sequence Right ¯anking sequence
E.coli 100 bp 4229991±4230091 GACCGGGATATCGCTGC¼ ¼TCAATGCGTTTTGCTGC
E.coli 150 bp 1976452±1976602 CAACGGAGGGGGGCTGC¼ ¼GCAGCTCCACCGATTTT
E.coli 200 bp 4224653±4224853 GCAGCACGATGATTACA¼ ¼CACCATCTGGGAGCTGC
Human 125 bp Chr19: 50040675±50040800 GCAGCACTATCCACAACAGCA¼ ¼GCAGCAAAAGCAAACAT
Human 262 bp Chr19: 50152102±50152364 GCAGCCCTGTGGTCACCAGGA¼ ¼GGGGACTCACCACCTTGCTGC
Human 318 bp Chr19: 51678472±51678790 GCAGCCACACAGGGCCATTGG¼ ¼GCAGCACACCACCACGC
Human 499 bp Chr19: 51876594±51877093 CTATCCCGTGGAGCTGC¼ ¼GCAGCGTGGTGCTGGAT
The BbvI recognition site is highlighted in bold and the 4-base 5¢ overhang sequence generated is underlined. The position of the second 4-base 5¢ overhang
generated by digestion from the adapter incorporated recognition site is double underlined. The orientation of the cut site relative to the recognition site
appears to alternate depending upon which strand contains the recognition sequence GCAGC. Genomic locations are indicated for the position of the cut
sites. Escherichia coli genomic sequence was obtained from NC_000913.
chance of selecting an additional fragment to the one targeted disadvantage during the PCR phase. The addition of high GC
is 0.56. Multiplexing of the adapters in which all three were favorable components such as DMSO in addition to altering
combined into the one ligation also demonstrated the primer, magnesium and enzyme concentrations also failed to
successful ampli®cation of the three fragments. Further promote the appearance of the band.
Downloaded from http://nar.oxfordjournals.org/ by guest on August 16, 2015
optimization of adapter concentration and ligation conditions
may help to minimize non-speci®c bands.
DISCUSSION
Human genomic fragment isolation We have described a technique for the speci®c ampli®cation
To amplify four speci®c fragments from human genomic of DNA fragments from a complex genome using a small,
DNA of 125, 262, 318 and 499 bp in size (Table 1), two rounds universal set of adapter-forming oligonucleotides. In the
of selection were used. The ®rst round of capture was simplest construction of adapters, one of 256 variants for one
performed on BbvI-digested human genomic DNA using the strand and one of 256 variants for the other strand could be
four adapters either separately or in a pool of four adapters annealed, prior to ligation of the adapter to the genomic
(Fig. 4A). If it is assumed the genome is fragmented into 6 fragment. Alternatively, a pre-ligation of short overhang
million fragments as expected statistically for the BbvI digest, oligonucleotides to a common core adapter could be per-
then an adapter that is 1 of 32 768 variants will select about formed to generate the adapter as we have demonstrated here.
188 unique fragments. However, other structures are likely to There are 256 possible combinations of the bases at each end
form such as two or more genomic fragments ligated and of each adapter resulting in 65 536 possible adapters (func-
captured into the adapter circleÐbut their frequency will be tionally this equates to 32 768 unique adapters because of
lower. Figure 4A shows that after ampli®cation, DNA of a directional reversibility of the adapter). In this case a total of
range of sizes was produced but on average the distribution is 512 adapter oligonucleotides are all that is required to produce
centered around 500 bp. This distribution pattern is a result of all 32 768 possible variations of adapter overhangs. This
the frequency of cutting and also the polymerase extension effectively results in an adapter which, when ligated with a
time. fragmented genome of 6 million pieces, could capture in the
A single round of selection would provide an ~32 000-fold order of 188 unique fragments in a single round of selection.
puri®cation of genomic fragments and could provide a means The actual number and average size of genomic fragments
for partial or whole genome ampli®cation; however, the may, however, be controlled by performing digests with
ampli®cation of speci®c fragments from the human genome multiple enzymes.
would require two rounds of selection. After the ®rst round Many of the alternative techniques for sequence complexity
PCR with primer set A, the products were digested with FokI reduction currently available have found usefulness with small
enzyme which recognizes a 5-base sequence incorporated in bacterial genomes because of their inherent lower complexity.
the adapter but cuts into the captured genomic DNA. The For fragment selection on this scale our approach would be as
released DNA was re-ligated with an adapter speci®c for the simple, and more rapid than most techniques currently in use.
new overhangs generated in the genomic region of the ®rst- In our method, selection of a fragment from a bacterial
capture DNA. After ligation, the DNA was again digested with genome would only require a genomic digestion, ligation, a
Bal31 nuclease before ampli®cation with alternate PCR short nuclease digestion and one PCR to achieve the isolation
primers to those used in the ®rst round. When a single adapter of any fragment from the genome. Achieving single fragment
was used in each ligation for both the ®rst round and the isolation with other techniques is typically much more dif®cult
second rounds of selection, a single band was produced for the because they are unable to achieve such a degree of selection
125, 262, 318 and 499 bp products (Fig. 4B). When all four in as few steps.
adapters were combined for the ®rst step ligation and a second Two major applications of this technology would be for
set of four were combined for the second step ligation all high-throughput production of speci®c DNA amplicons
fragments were detected on the gel, except for the 499 bp for genotyping and mutation/polymorphism discovery.
fragment. We believe the failure to visualize the 499 bp Traditionally, this would require PCR with locus-speci®c
fragment in the multiplex reaction may be due to sequence primers and a large investment in the design, synthesis and
features of the fragment that are leading to a competitive testing of large number of primers. With Universal Selective
PAGE 5 OF 6 Nucleic Acids Research, 2004, Vol. 32, No. 2 e21
Figure 3. Isolation and ampli®cation of three fragments from the E.coli
genome. Adapters with common primer binding sites (primer set A) were
prepared with 5¢ overhangs speci®c for fragments of 100, 150 and 200 bp in
size from the E.coli genome and ligated to BbvI-digested genomic DNA.
The ligations were treated with Bal31 exonuclease before NotI digestion
and PCR ampli®cation using primer set A and Taq polymerase as described
in the Materials and Methods. Lane 1, 100 bp; lane 2, 150 bp; lane 3,
200 bp; lane 4, mix of 100, 150 and 200 bp adapters in the ligation; lane 5,
Downloaded from http://nar.oxfordjournals.org/ by guest on August 16, 2015
50 bp marker (Promega). PCRs (2 ml) were electrophoresed on 4% Nusieve
agarose (FMC) and visualized with Gelstar stain. Expected bands (arrowed)
run at higher molecular weights than the genomic fragments due to primer
and adapter sequences that are co-ampli®ed.
Ampli®cation, as we have described here, even high through-
put, single-plex reactions would be more feasible. PCR Figure 4. (A) First-round ampli®cation of four fragments from the human
conditions can be standardized through the use of common genome. Adapters with common primer binding sites (primer set A) were
prepared with 5¢ overhangs speci®c for fragments of 125, 262, 318 and
primers to allow parallel ampli®cation of speci®c loci, without 499 bp in size from the human genome and ligated to BbvI-digested human
the need for designing primers and optimizing conditions for genomic DNA. The ligations were treated with Bal31 exonuclease before
each locus. Furthermore, greater cost savings could be realized PCR ampli®cation using Vent polymerase and primer set A as described in
by assembling all necessary adapters from a universal set of the Materials and Methods. Lane 1, 50 bp marker (Promega); lane 2, 125 bp
less than 1000 oligonucleotides. The ability to perform adapter; lane 3, 262 bp adapter; lane 4, 318 bp adapter; lane 5, 499 bp
adapter; lane 6, mix of 125, 262, 318 and 499 bp adapters in the ligation;
multiplex isolations of fragments, by combining many pre- lane 7, 1 kb marker (NEB). Qiaquick (Qiagen) puri®ed PCRs (3 ml) were
annealed adapter oligonucleotides in the one reaction, is also electrophoresed on 3% agarose and visualized with Gelstar stain (Cambrex).
possible because a common primer set can be employed to (B) Second-round ampli®cation of four fragments from the human genome.
amplify the captured DNA. Double-sided adapters would be Adapters with common primer binding sites (primer set B) were prepared
with 5¢ overhangs speci®c for the second overhangs generated from
critical for isolating tens of DNA fragments in one reaction fragments of 125, 262, 318 and 499 bp in size from the human genome and
because a mixture of all required pairs of earlier proposed ligated to the FokI digested DNA. The ligations were treated with Bal31
single-sided adapters would produce an exponential number of exonuclease before PCR ampli®cation using Vent polymerase and primer
undesired adapter combinations that would capture an excess set B as described in the Materials and Methods. Lane 1, 50 bp marker
(Promega); lane 2, 125 bp; lane 3, 262 bp; lane 4, 318 bp; lane 5, 499 bp;
of unwanted DNA. Due to removal of linear non-targeted lane 6, mix of 125, 262, 318 and 499 bp adapters in the ligation, PCRs (2 ml)
DNA our process may also have advantages in producing were electrophoresed on 3% agarose and visualized with Gelstar stain.
highly de®ned low complexity genomic fractions comprised Expected bands (arrowed) run at higher molecular weights than the genomic
of hundreds or thousands of DNA fragments scattered over the fragments due to primer and adapter sequences that are co-ampli®ed.
genome by using one, multiple or degenerate adapters.
The use of a single primer pair for the ampli®cation of issues for large multiplexing experiments, alternatives such as
multiple fragments in the one reaction, could however, isothermal ampli®cation (17) or the selection of shorter
introduce other issues that impact upon PCR-based ampli®- fragments that are less in¯uenced by sequence factors may
cation. Since each amplicon has the same primer binding site, prove more effective. Isothermal ampli®cation in particular
competition between newly formed product and primers, as in should result in less in¯uence from primer competition for the
any PCR, may lead to reduced yields of any one fragment in annealing target as occurs during each cycle of the PCR.
later cycles. In addition, if the rate of full-length product Although the 499 bp fragment was not visualized on the gel it
formation is dramatically different for some amplicons this may be present below the detection limit of the stain.
may give a competitive advantage to more ef®cient amplicons Complete suppression would appear to be unlikely since
that out-compete the less ef®cient amplicons over time. These during the ®rst round of selection with a single adapter several
factors may underlie our observations for one fragment; a GC- hundred unique sequences were ampli®ed and from these, the
rich amplicon of 499 bp that appeared to be suppressed by the 499 bp fragment could be isolated on the second round of
ampli®cation of other amplicons with the same primer binding selection, suggesting the ®rst round of selection was ampli-
sites in a multiplex reaction. Other possibilities for fying the 499 bp fragment within a multiplex of hundreds of
this suppression may include differences in target concentra- fragments.
tion (post-ligation) as a result of incomplete digestion or Although we have chosen exonuclease digestion to remove
differences in ligation ef®ciencies. To overcome some of these unwanted fragments and adapter sequences in this study, other
e21 Nucleic Acids Research, 2004, Vol. 32, No. 2 PAGE 6 OF 6
options are feasible such as a biotinylated, fully degenerated reactions before the intended DNA ampli®cation, is one that is
blocking adapter that ligates to unused overhang sequences, cost-effective by utilizing a relatively small set of oligonu-
which can then be removed by streptavidin coated beads. Used cleotides and one that can be easily standardized to allow rapid
in an effective concentration, the blocking adapter can also and parallel ampli®cation of required genomic DNA
reduce formation of undesired circles comprised of multiple fragments for high through-put genomic analysis in various
non-targeted DNA fragments with or without an adapter. The species.
Universal Selective Ampli®cation procedure could also be
further simpli®ed by possibly eliminating PCR after ligating
the ®rst adapter. In addition, cutting circular DNA and ligation ACKNOWLEDGEMENTS
of a second adapter may be performed in the same reaction if This work was funded by The National Institute of Standards
two different adapter cores are used. The ®rst adapter would and Technology, Advanced Technology Program Project ID:
use a core that has no priming sites but has two Type IIs 200-00-4467A
restriction enzyme recognition sequences, and the second
adapter would use a core that has priming sites but has no
restriction enzyme recognition sequences. REFERENCES
There are at least three commercially available Type IIs
1. Roberts,R.J., Vincze,T., Posfai,J. and Macelis,D. (2003) REBASE:
enzymes that produce 4-base overhangs, and are not sensitive restriction enzymes and methyltransferases. Nucleic Acids Res., 31,
to CpG methylation (BbvI, FokI and BspMI). There are also a 418±420.
Downloaded from http://nar.oxfordjournals.org/ by guest on August 16, 2015
number of alternative Type IIs enzymes available should the 2. Smith,D.R. (1992) Ligation-mediated PCR of restriction fragments from
user choose not to use a 4-base overhang. Another alternative large DNA molecules. PCR Methods Appl., 2, 21±27.
for increasing the number of enzymes available (by avoiding 3. Unrau,P. and Deugau,K.V. (1994) Non-cloning ampli®cation of speci®c
DNA fragments from whole genomic DNA digests using DNA
CpG methylation issues) is to treat the genomic DNA with one `indexers'. Gene, 145, 163±169.
of a number of whole genome ampli®cation methods available 4. Guilfoyle,R.A., Leeck,C.L., Kroening,K.D., Smith,L.M. and Guo,Z.
to generate non-methylated DNA. An additional six enzymes (1997) Ligation-mediated PCR ampli®cation of speci®c fragments from a
that produce 4-base overhangs would be available in this case. class-II restriction endonuclease total digest. Nucleic Acids Res., 25,
1854±1858.
Our adapter assembly process, based on universal complete 5. Sibson,D.R. and Gibbs,F.E. (2001) Molecular indexing of human
libraries of oligonucleotide building blocks, allows other genomic DNA. Nucleic Acids Res., 29, e95.
advanced features to be engineered into the adapters such as 6. Kim,S.C., Podhajska,A.J. and Szybalski,W. (1988) Cleaving DNA at any
internal informative cleavage sites that expose an overhang predetermined site with adapter-primers and class-IIS restriction
complementary to an overhang from the genomic sequence enzymes. Science, 240, 504±506.
7. Velculescu,V.E., Zhang,L., Vogelstein,B. and Kinzler,K.W. (1995)
after cleavage of the formed circles. Having two additional Serial analysis of gene expression. Science, 270, 484±487.
pairs of 256-oligonucleotide libraries allows one to make 8. Vos,P., Hogers,R., Bleeker,M., Reijans,M., van de Lee,T., Hornes,M.,
adapters with 16 informative bases in one assembly reaction Frijters,A., Pot,J., Peleman,J., Kuiper,M. et al. (1995) AFLP: a new
that would replace pairs of standard double-sided adapters technique for DNA ®ngerprinting. Nucleic Acids Res., 23, 4407±4414.
designed for two rounds of selection of a DNA fragment. In 9. Nelson,D.L., Ledbetter,S.A., Corbo,L., Victoria,M.F., Ramirez-Solis,R.,
Webster,T.D., Ledbetter,D.H. and Caskey,C.T. (1989) Alu polymerase
this case two speci®c internal 4mers would be incorporated, in chain reaction: a method for rapid isolation of human-speci®c sequences
addition to the two speci®c 4-base overhangs. In other from complex DNA sources. Proc. Natl Acad. Sci. USA, 86, 6686±6690.
envisioned improvements, by designing several adapter 10. Ledbetter,S.A., Nelson,D.L., Warren,S.T. and Ledbetter,D.H. (1990)
cores with different assembly overhangs, coupled with Rapid isolation of DNA probes within speci®c chromosome regions by
interspersed repetitive sequence polymerase chain reaction. Genomics, 6,
corresponding libraries of building blocks, multiple double- 475±481.
sided adapters could be assembled simultaneously. This could 11. Telenius,H., Carter,N.P., Bebb,C.E., Nordenskjold,M., Ponder,B.A. and
occur during adapter ligation to genomic DNA to produce a Tunnacliffe,A. (1992) Degenerate oligonucleotide-primed PCR: general
multiplexed DNA ampli®cation without prior pre-assembly of ampli®cation of target DNA by a single degenerate primer. Genomics,
each individual adapter in its own separate assembly reaction. 13, 718±725.
12. Cheung,V.G. and Nelson,S.F. (1996) Whole genome ampli®cation using
In conclusion, we have described a strategy for the a degenerate oligonucleotide primer allows hundreds of genotypes to be
ampli®cation of speci®c genomic DNA fragments that utilizes performed on less than one nanogram of genomic DNA. Proc. Natl Acad.
a small, but universal set of oligonucleotides. The novel Sci. USA, 93, 14676±14679.
features of this approach include the ability to achieve greater 13. Jordan,B., Charest,A., Dowd,J.F., Blumenstiel,J.P., Yeh Rf,R.F.,
selection speci®city through the use of double-sided adapters Osman,A., Housman,D.E. and Landers,J.E. (2002) Genome complexity
reduction for SNP genotyping analysis. Proc. Natl Acad. Sci. USA, 99,
and DNA circle formation, and to such a degree that 2942±2947.
ampli®cation of selected fragments from the human genome 14. Dong,S., Wang,E., Hsie,L., Cao,Y., Chen,X. and Gingeras,T.R. (2001)
is possible. Due to high selectivity, any speci®c sequence can Flexible use of high-density oligonucleotide arrays for single-nucleotide
be isolated using millions of fragments obtained by mixing polymorphism discovery and validation. Genome Res., 11, 1418±1424.
15. Kennedy,G.C., Matsuzaki,H., Dong,S., Liu,W.M., Huang,J., Liu,G.,
independent Type IIs restriction enzyme digests prior to Su,X., Cao,M., Chen,W., Zhang,J. et al. (2003) Large-scale genotyping
adapter ligation or by performing multiple digests on the same of complex DNA. Nat. Biotechnol., 21, 1233±1237.
DNA. The adapter ligation technique is also advantageous in 16. Russell,D.W. and Sambrook,J. (2001) Molecular Cloning: A Laboratory
ef®cient ampli®cation of various DNA sequences because it Manual. 3rd Edn. Cold Spring Harbor Laboratory Press, Cold Spring
uses only universal primers under the same optimized Harbor, NY.
17. Dean,F.B., Nelson,J.R., Giesler,T.L. and Lasken,R.S. (2001) Rapid
conditions, as indicated by the successful preparation of all ampli®cation of plasmid and phage DNA using Phi 29 DNA polymerase
seven selected amplicons on the ®rst attempt. The procedure and multiply-primed rolling circle ampli®cation. Genome Res., 11,
we have described, although requires a few preparatory 1095±1099.
Snezana Drmanac
